| AGK233 |
C. elegans |
unc-119(ed3) III; niDf199 IV; armEx58. Show Description
armEx58 [WRM0611aH08-Del8mer + unc-119(+)]. Pick non-Unc to maintain. This strain contains a transgenic array that expresses a derivative WRM0611aH08 fosmid. The WRM0611aH08 fosmid contains the niDF199 locus (around 4 kb) that is deleted in the natural C. elegans isolate strain JU258. JU258 worms lack specific 21U-RNAs normally present in N2 worms due to this deletion of the niDF199 locus. This derivative fosmid construct lacks the upstream 8-mer motif (CTGTTTCA) next to 21U-3372. The expression of this individual 21U-RNA is lost in transgenic animals. unc-119(ed3) was crossed into JU258, the niDf199IV deletion was confirmed by PCR, and these Unc worms were used for bombardment. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45.
|
|
| AGK234 |
C. elegans |
unc-119(ed3) III; niDf199 IV; armEx53. Show Description
armEx53 [WRM0611aH08 + unc-119(+)]. Pick non-Unc to maintain. unc-119(ed3) was crossed into JU258, the niDf199IV deletion was confirmed by PCR, and these Unc worms were used for bombardment. This strain contains a transgenic array that expresses the WRM0611aH08 fosmid construct. This fosmid contains the niDF199 locus (around 4 kb) that is deleted in the natural C. elegans isolate strain JU258. JU258 worms lack specific 21U-RNAs normally present in N2 worms due to this deletion of the niDF199 locus. Expression of this fosmid construct in JU258 worms restores the expression of the missing 21U-RNAs in the germline, as measured by RT-qPCR. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45.
|
|
| AV40 |
C. elegans |
mnDp66 (X;I); meDf4 X. Show Description
Produces 27% XO male self progeny; nondisjunction is correlated with a high frequency of achiasmate X chromosomes in oocyte nuclei, and a reduced frequency of X chromosome crossovers. meDf4 disrupts the function of the cis-acting X chromosome meiotic pairing center. meDf4/+ heterozygotes produce 4-6% XO progeny, so the presence of meDf4 can be followed in heterozygotes by this weak Him phenotype.
|
|
| BC13008 |
C. elegans |
dpy-5(e907) I; sEx13008. Show Description
sEx13008 [rCesH22D14.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC13132 |
C. elegans |
dpy-5(e907) I; sEx13132. Show Description
sEx13132[rCesH22D14.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC700 |
C. elegans |
sDf4/bli-4(e937) dpy-14(e188) I. Show Description
Heterozygotes are semi-Dpy and segregate more semi-Dpy, Dpy(ts)Bli(late) and early larval lethals. Pick semi-Dpy to maintain. (Some reports indicate that sDf4 is not transferred through sperm.) This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
|
|
| BP395 |
C. elegans |
hyEx167. Show Description
hyEx167 [4.5kb aff-1p::GFP transcriptional fusion + rol-6(su1006)]. Shows cytoplasmic GFP expression in embryonic hyp5. In L1 hermaphrodite larva, aff-1::GFP is expressed in pharyngeal muscle 3 and 5, in sheath cells of chemosensory neurons, and in tail neurons. In L3 hermaphrodites, the transgene is expressed in the anchor cell; this expression proceeds in L4 along with expression in the utse cells, the seam cells and cells of vulval rings A and D. In adults, aff-1::GFP is expressed in the sheath cells of chemosensory neurons and in head interneurons, uterus toroids 2 and 4, in the vulva VulD, utse, and seam cells. Worms of hyEx167 are slightly Egl. Maintain by picking Rollers.
|
|
| BP75 |
C. elegans |
eff-1(hy21) II. Show Description
Temperature sensitive. Cell fusion-defective embryos, larvae and adults at 25C. Cell fusion defects are less penetrant at 15C. Egl, Unv, Pvl, Dpy and 2% Muv at 20C and 25C. Mutants have body morphological defects and bulged tails at all temperatures, male tails are leptoderan. Partial sterility of hermaphrodites: brood size is 48 at 25C. sd-4%. ME=0. ES=3. OA-1 (oj55: complete embryonic and partial post-embryonic epithelial fusion failure). Cloned: encodes a type-I membrane glycoprotein with a single TM domain.
|
|
| BS585 |
C. elegans |
unc-13(e51) ozDf5 I; nDp4 (I;V)/+. Show Description
Strain gives WT hermaphrodites and dead eggs.
|
|
| CB2770 |
C. elegans |
eDf4/eDf24 I. Show Description
Heterozygotes are WT and segregate WT, dead eggs, and larval lethals (eDf24 homozygotes). eDf24 = let(e2000).
|
|
| CHS1190 |
C. elegans |
srd-1(yum2136) srd-2(yum2137) srd-3(yum2138) srd-4(yum2139) srd-5(yum2140) srd-7(yum2141) srd-8(yum2142) srd-9(yum2143) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CL208 |
C. elegans |
srf-9(dv4) him-5(e1490) V. Show Description
Animals are somewhat smaller than WT and commonly have a protruding vulva. Unc(slow moving and non-sinusoidal body posture). Egl. Ectopic surface binding of the lectins WGA and SBA. Males are infertile and Mab.
|
|
| DM3004 |
C. elegans |
unc-112(r367) V; raDf4/+ X. Show Description
The unc-112(r367); raDf4/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf4 homozygotes arrest as L2 larvae. raDf4 deletes dim-1.
|
|
| DR1786 |
C. elegans |
dpy-13(e184) unc-24(e138) IV; mDp4[unc-17(e245)] (IV;?). Show Description
WT phenotype. Segregates WT and DpyUncs. mDp4 carries dpy-13(+) and unc-24(+). Duplication may recombine with normal homologues. Presence of unc-17(e245) on mDp4 confirmed: got Unc-17 segregants after heat shock of this stock to generate males. Pick WT and check for segregation of progeny to maintain.
|
|
| DR799 |
C. elegans |
mDf4/nT1 IV; +/nT1 V. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul and dead eggs. Maintain by picking semi-Dpy. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle.
|
|
| EM253 |
C. elegans |
mab-20(bx61) I; him-5(e1490) V. Show Description
Ray 3 and 4 fusion >60% at non-permissive temp. Ray 1 and 2 fusion about 10% at non-permissive temp. ts period is around L3-L4.
|
|
| EU828 |
C. elegans |
dhc-1(or195) I. Show Description
Homozygous or195 hermaphrodites make 100% dead embryos at 26C. One-cell embryo has a very small but bipolar spindle, severe chromosome segregation defect. Maintain at 15C. Previously called spd-4. 2/06: From Bruce Bowerman: The or195 mutation changes base 10,679 of the cosmid clone T21E12 from a C to a T. This corresponds to dhc-1 cDNA nucleotide 9599 (WS153) , which is the center nucleotide of codon 3200. This codon changes from Serine in N2 to Leucine in or195 (S3200L). Note: this is not the same mutation for or195ts that we reported in Hamill et al, 2002(Dev Cell 3, 673-684). The mutation reported in our paper is not present in this strain. We apologize for the confusion. The pairs dhc-11a,b amplify the mutated fragment in dhc-1(or195). The mutation is near the center of this fragment; a clean (gel purified) DNA prep helps get a good read of it. dhc-11b: 5' aacagacgcacgattgacct 3'. dhc-11a: 5' ctcaaatcaaggaaggagct 3'. PCR conditions: 5 min at 94 degrees C; 30 sec at 94 degrees C; 30 sec at 55 degrees C; 1 min at 72 degrees C. 35 Cycles using Taq polymerase.
|
|
| EV190 |
C. elegans |
gld-4(ef15) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous nearly sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ef15 homozygotes (pale, nearly sterile, lays few eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Schmid M, et al. Genes Dev. 2009 Apr 1;23(7):824-36.
|
|
| EW51 |
C. elegans |
pvl-5(de4) II. Show Description
de4 is a weaker allele of pvl-5. Weakly penetrant Egl and Pvl phenotype. Low penetrance embryonic lethal and gonad migration defects. pvl-5(de4) animals have fewer Pn.p cells in the ventral midline at mid-L2 larval stage.
|
|
| GA416 |
C. elegans |
sod-4(gk101) III. Show Description
Superficially wild-type.
|
|
| GE1549 |
C. elegans |
tDf4 dpy-5(e61)/szT1 [lon-2(e678)] I; dpy-8(sc44)/szT1 X. Show Description
Heterozygotes are WT and segregate WT, dead eggs, and Lon males. Maintain by picking WT. Strain will occasionally throw some DpysRollers.
|
|
| GR1371 |
C. elegans |
lars-2(mg312) unc-29(e1072) I; nDp4 (I;V)/+. Show Description
lars-2(mg312) unc-29(e1072) homozygotes are Unc, slow growing, sterile, and have extended life span. Balanced worms are slightly Egl, otherwise WT.
|
|
| HY601 |
C. elegans |
mat-3(or344) III. Show Description
Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 25C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-4(or344).
|
|
| IMN34 |
C. elegans |
ced-4(n1162) dpy-17(e164) III; glt-3(bz34) IV; nuIs5 V. Show Description
nuIs5 [glr-1::GFP + glr-1::G(alpha)s(Q227L) V + lin-15(+)] V. Reference: Tehrani N, et al. (2014) PLoS One 9(11):e113060.
|
|
| JDW389 |
C. elegans |
bli-1(wrd84[bli-1::linker::mNeonGreen::3xFLAG(internal)::linker]) II. Show Description
Internal mNeonGreen::3xFLAG tags with linker sequences inserted into endogenous bli-1 locus. Superficially wild-type. Reference: Johnson LC, et al. Development 2023; dev.201085. doi: https://doi.org/10.1242/dev.201085.
|
|
| JR728 |
C. elegans |
sqt-3(sc8) unc-61(e228)/wDf4 V. Show Description
Pick WT to maintain. Throws WT, Roller Uncs and dead eggs. wDf4 arrests as dead eggs with no gut. sc8 previously called rol-4(sc8).
|
|
| JT11069 |
C. elegans |
xbx-1(ok279) V. Show Description
Dyf. Osm. Reduced mating efficiency (ME 2-3). Deletion extends over 1610 bp in the intron between exons 3 and 4 and ending 30 bp after the STOP codon (cosmid F02D8 pb 25954-27563 are deleted). Complements dyf-4(m158).
|
|
| JT666 |
C. elegans |
hid-4(sa666) IV. Show Description
Hid.
|
|
| JU852 |
C. elegans |
C. elegans wild isolate. Show Description
Sampled in a compost heap in vegetable gardens/vineyards (Bas-Rhin), France on 3 Oct 05 by MAF. Plated 4 Oct, picked as L4 on 4 Oct 05. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| KR1239 |
C. elegans |
unc-11(e47) dpy-5(e61) I; hDp4 (I;f). Show Description
Unc phenotype. Slow. DpyUnc will take over. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
|
|
| KR2406 |
C. elegans |
eDf4/hIn1 [unc-101(sy241)] I. Show Description
Wild type, segregating Unc-101 (hIn1[unc-101] homozygotes), wild type and arrested embryos. eDf4 homozygote arrests as unhatched embryo at lima bean stage. Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
|
|
| KX89 |
C. elegans |
ced-4(n1162)
III; bcIs39 V. Show Description
bcIs39 [lim-7p::ced-1::GFP and lin-15(+)] V. Resistant to germ cell apoptosis. No apoptosing germ cells are decorated by CED-1::GFP in the gonad. Genetically identical to KX87 (Contreras, V., et al, 2011).
|
|
| LIU86 |
C. elegans |
dhs-28(ldr4) X; ldrIs1; ldrIs2. Show Description
ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. ldrIs2 [mdt-28p::mdt-28::mCherry + unc-76(+)]. ldr4 is a G-to-A mutation in the splice donor site of Intron 1. Super-sized lipid droplets. [NOTE: The positions indicated in the original Figure 1C of Xie, et al. (2019) are based on an incorrect sequence map and do not reflect the position of the affected amino acid or position in a spliced transcript. The G-to-A mutation in the splice donor site is correct and has been independently confirmed by sequence analysis in another lab.] Reference: Xie K, et al. Sci Rep. 2019 Oct 17;9(1):14902. doi: 10.1038/s41598-019-51399-z. PMID: 31624276
|
|
| MAH23 |
C. elegans |
rrf-1(pk1417) I. Show Description
pk1417 outcrossed 4 times to N2. Reference: Kumsta C, Hansen M. PLoS One. 2012;7(5):e35428.
|
|
| MCJ11 |
C. elegans |
mir-35(cdb2 cdb4) II. Show Description
Superficially wild-type. Seed mutation of mir-35 was made by two rounds of CRISPR/Cas9 editing. cdb2 is a 50 bp deletion of the mir-35 locus. cdb4 was created by successive homology-directed repair of the disrupted mir-35 locus with a protospacer to preserve the secondary structure of the primary and precursor hairpin. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039
|
|
| MCJ213 |
C. elegans |
egl-1(cdb97) V. Show Description
Brood size slightly reduced at 25 degrees. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039
|
|
| MCJ217 |
C. elegans |
mir-35(cdb2 cdb4) II; egl-1(cdb97) V. Show Description
Superficially wild type. Seed mutation of mir-35 was made by two rounds of CRISPR/Cas9 editing. cdb2 is a 50 bp deletion of the mir-35 locus. cdb4 was created by successive homology-directed repair of the disrupted mir-35 locus with a protospacer to preserve the secondary structure of the primary and precursor hairpin. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039
|
|
| MCJ219 |
C elegans |
sup-26(cdb99) nhl-2(cdb100) III; egl-1(cdb97) V. Show Description
nhl-2(cdb100) contains engineered mutations in the mir-35 binding site in the nhl-2 3UTR region making the sequence complementary to the mir-35(cdb4) variant. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the egl-1 3UTR region making the sequence complementary to the mir-35(cdb4) variant. Slightly reduced brood size at 25C. Reference: Donnelly BF, et al. (2022). Cell Reports.
|
|
| MCJ259 |
C. elegans |
cex-2(cdb130) mir-35(cdb2 cdb4) II; T28D6.4(cdb133) unc-49(cdb134) IV; egl-1(cdb97) V. Show Description
Superficially wild-type. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039
|
|
| MD5018 |
C. elegans |
ced-4(dx226[ced-4::mNeonGreen]) III. Show Description
mNeonGreen tag inserted at C-terminus of endogenous ced-4 locus. Generated in N2 background. Reference: Lambie EJ, et al. Cell Death Differ. 2025 Aug 27. doi: 10.1038/s41418-025-01567-8. PMID: 40866673.
|
|
| MLC1390 |
C. elegans |
lucEx825. Show Description
lucEx825 [tbx-34::T2A::GFP::H2B::tbx-34 3'UTR + ttx-3p::mCherry]. Pick mCherry+ animals to maintain. Wild-type morphology. Extrachromosomal tbx-34 reporter includes 755 bp of tbx-34 upstream region and 4.4 kb of downstream region. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
|
|
| MQ1766 |
C. elegans |
sod-2(ok1030) I; sod-5 (tm1146) sod-1(tm783) II; sod-4(gk101) III; sod-3(tm760) X. Show Description
Normal lifespan. Increased sensitivity to oxidative stress, osmotic stress, cold stress, and heat stress. Slow development, slow physiological rates (thrashing, defecation), and reduced fertility. van Raamsdonk J & Hekimi S. Proc Natl Acad Sci U S A. 2012 Apr 10;109(15):5785-90.
|
|
| MT15884 |
C elegans |
csp-3(n4872) I. Show Description
n4872 is a 722 bp deletion that removes part of exon 2 and all of exons 3 and 4. Reference: Denning DP, et al. PLoS Genet. 2013;9(3):e1003341.
|
|
| MT2547 |
C. elegans |
ced-4(n1162) III. Show Description
Cells that normally die survive. [3/02: A mutation that was not reported (nucleotide 1251 C-> T causing codon 80 ->ochre) was found by Tak Hung. It turns out the mutation was misannotated in the original paper (Development, 1992, 116:309). Bob Horvitz also confirmed the discovery.
|
|
| MT2550 |
C. elegans |
unc-79(e1068) ced-4(n1162) III. Show Description
Unc. Cells that normally die survive.
|
|
| MT2551 |
C. elegans |
ced-4(n1162) dpy-17(e164) III. Show Description
Dpy. Cells that normally die survive.
|
|
| MT2936 |
C. elegans |
unc-13(e51) I; nDp4 (I;V)/+. Show Description
Animals heterozygous for the duplication are WT. Animals which have lost the duplication are Unc. Animals homozygous for the duplication are viable. They are small, sickly Egl worms which don't give rise to Uncs.
|
|
| MT3315 |
C. elegans |
ced-4(n1416) III; egl-1(n986) V. Show Description
Absence of cell death. See WBG 10(1):31.
|
|
| MT5287 |
C. elegans |
ced-4(n1894) III. Show Description
|
|
| MT5816 |
C. elegans |
ced-4(n2273) III. Show Description
Weak defects in protection and killing.
|
|