Search Strains

frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Displays tpa-1 phenotypes (e.g. resistance to PMA). Isolated in a genetic screen for mutants failing to show an induction of nlp-29p::GFP reporter gene expression upon infection with the fungus Drechmeria coniospora (the Nipi phenotype). References: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9. Ziegler K, et al. Cell Host Microbe. 2009 Apr 23;5(4):341-52.

frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Displays tpa-1 phenotypes (e.g. resistance to PMA). Isolated in a genetic screen for mutants failing to show an induction of nlp-29p::GFP reporter gene expression upon infection with the fungus Drechmeria coniospora (the Nipi phenotype). References: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9. Ziegler K, et al. Cell Host Microbe. 2009 Apr 23;5(4):341-52.

Putative null allele which lacks whole of the first exon of the gene (lacking 361 bp area corresponding to 13460-13820 of the cosmid F13G3). Severe thermotaxis defect. Weak defects in chemitaxis. Subcellular localization of synaptic proteins is abnormal in RIA interneurons.

kpIs100 [pie-1p::Ub(G76V)::GFP::H2B::drp-1 3' UTR + unc-119(+)]. [NOTE: (4/4/2025): Strain segregates Rol, and non-Rol, possibly due to a background dpy-10 mutation; both express GFP as expected. It was recommended that non-Rollers be picked when maintaining the strain.] Expresses Ubiquitin::GFP fusion protein in the germ line. The last amino acid of ubiquitin is mutated to valine (G76V), which prevents the cleavage of ubiquitin from GFP by the deubiqutinating enzymes and renders the GFP constitutively targeted for degradation by the proteasome. The strain can be used to assay proteasome activity in the germ line. Reference: Kumar GA & Subramaniam K. Development. 2018 Mar 29;145(7):dev163949. PMID: 29540500

mNG tag inserted into endogenous mls-2 locus after the start codon using CRISPR/Cas9 engineering, producing a translational mNG::MLS-2 reporter protein. Derived by SEC excision of mls-2(vy247[mNG::SEC::mls-2 knock-in]) in parental strain. mNG::MLS-2 is detected in the nucleus of a few cells in embryos, and localizes to the nucleus of a subset of head cells and the M mesoblast in larvae and adults. Reference: Xiong R., et al. (2022). mNG-tagged mls-2 knock-in alleles in C. elegans. microPublication Biology. 10.17912/micropub.biology.000529.

jcpEx2 [ced-1p::F58G11.6(genomic)::YFP::let-858 3'UTR + unc-119(+) + myo-2::GFP]. Maintain by picking GFP+. Individuals that lost the array produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.

jcpEx3 [ccz-1p::ccz-1(genomic)::YFP::let-858 3'UTR + unc-119(+) + pha-1(+)]. Array rescues lethality. Individuals that lost the array produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.

Modest ivermectin resistance. Mild feeding defect. Lacks M3 neurotransmission. Reference: Dent JA, et al. Proc Natl Acad Sci U S A. 2000 Mar 14;97(6):2674-9.

Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally in the first exon of the endogenous acn-1 locus by CRISPR. Will produce a linker::mNG::3xFLAG::linker fusion after the 32nd amino acid. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.

Modular linker::mNeonGreen::3xFLAG::linker tag inserted in the first exon after the signal sequenceof the endogenous srap-1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.

Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally in the last exon of the endogenous lrp-1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.

vpIs9 [unc-119(+) + elt-1::GFP] Expresses in hypodermal precursor cells in early embryo and seams cells in late embryos and in seam cells at a low level throughout post-embryonic development. Also in ventral cord and retropharyngeal ganglion in larvae and adults, and vulval muscles in adults.

No visible phenotype except for reduced brood size. Synthetic sterile with nos-2(RNAi). 1176 bp deletion starting at aa 58 in nos-1 ORF and ending 414 bp past the end of the nos-1 ORF.

axEx1125 [pie-1p::mex-5::GFP::pie-1 3’UTR + rol-6(su1006) + N2 genomic DNA]. Maintain at 25C. Pick Rollers to maintain. axEx1125 contains pKR2.04, a construct carrying MEX-5::GFP in vector pKR1.42; pKR1.42 uses the pie-1 promoter, enhancer, and 3′ UTR to drive maternal expression of GFP in embryos. Animals with the array are Rollers. Animals which have lost the array are WT.

Heterozygotes are WT and segregate WT, Uncs which give only dead eggs, and dead eggs. mbk-2(pk1427) is a deletion that removes most of the mbk-2 locus.

Maintain at 20C. ax2033 was produced by replacing +16 to +42 with TCGACTCTCGAACGATCGTAATAG in the first exon of nos-2. ax2033 mutants are sterile when fed nos-1 dsRNA. Reference: Paix A, et al. Genetics. 2014 Sep 23.

Deletion removing 733 base pairs upstream of start and the first 2565 bases of the endogenous meg-4 locus. Reference: Wang JT, et al. eLife 2014;3:e04591.

Animals with the duplication are WT. Animals which have lost the duplication are Dpy and give only dead eggs.

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. HIS-72::GFP can be detected in germline and most somatic nuclei, but not in intestinal nuclei. Not integrated on X.

zuEx181[his-72(1kb 5' UTR)::YFP::GSRPVAT::HIS-72::HIS-72 (1KB 3'UTR) + 5.7 kb XbaI - HindIII UNC-119(+)]. HIS-72::YFP signal can be detected in the germline and most somatic nuclei, but not in intestinal nuclei.

zuEx182[his-71(1kb 5' UTR):: HIS-71::GSRPVAT::GFP::::HIS-71 (1KB 3'UTR) + 5.7 kb XbaI - HindIII UNC-119(+)]. HIS-71::YFP signal can be detected in most somatic nuclei, including the intestinal nuclei, but is not detected in the germline.

Heterozygotes are WT and segregate WT, small scrawny slow-growing Uncs, and females. Do not distribute this strain; other labs should request it from the CGC.

Animals with the Duplication are WT. Animals which have lost the Duplication are Dpy and Sterile. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT. Segregates Dpy Uncs, and females (primary spermatocyte death). Do not distribute this strain; other labs should request it directly from the CGC.

Temperature sensitive - raise at 15C. Do not distribute this strain; other labs should request it directly from the CGC.

Heterozygotes are WT and segregate WT, DpyUncs and DpySteriles. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, Dpy Fogs, and Uncs. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, Uncs, and Lags (ts). Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are Unc. [Note from Kimble lab: Min Han did a complementation test on this strain and found that unc-34(e315) is lost from this strain.] Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are Unc. [Used to be listed in Kimble lab as unc-5(e53); lag-2(q411 dpy-11(e224)/DnT1. Needs to be checked.] Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, DpyUnc and early larval lethals. Received new stock 5/98. Check carefully for segregation of Dpy Unc progeny; dpy-13 can be lost easily. Do not distribute this strain; other labs should request it from the CGC.

Temperature sensitive. Maintain at 15C. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, Dpy(ts) Uncs, and Lag L1 lethals (not ts). Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, DpyUnc and sterile hermaphrodites. Maintain by picking fertile WT hermaphrodites. q465 previously called mog-6. cyn-4 previously called cyp-4. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are wild-type and segregate wild-type, Unc-36 (eT1 homozygotes), homozygous Mog (Unc, weak coiler). Maintain by picking wild-type. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, Unc Egls and females. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, non-conditional dauers, and Sterile Dpys. Do not distribute this strain; other labs should request it directly from the CGC.

Heterozygotes are Unc. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, DpyUncs and steriles with a tumorous germline. Pick WT to maintain. Do not distribute this strain; other labs should request it from the CGC.

At 15C heterozygotes are Rollers and segregate Rollers, Sqt and Steriles. Not a healthy strain; recombination occurs, too. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, Sterile Unc coilers, Unc-36s (eT1 homozygotes) and dead eggs. Pick WT to maintain. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, Females which lack a pharynx (arrest as embryos or L1) and Sterile Unc Rollers. Do not distribute this strain; other labs should request it from the CGC. See also WBPaper00003770.

Heterozygotes are Ces and grow slowly. Hets segregate DpyUncs and dead eggs. ces-1(n703) is dominant. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are Srf and grow slowly. Hets segregate Srf, DpyUncSrf and dead eggs. ces-1(n703) is dominant. Do not distribute this strain; other labs should request it from the CGC. CGC rec'd new stock 10/99.

Heterozygotes are Ces and segregate VulUncs and dead eggs. ces-1(n703) is dominant. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are Ces and segregate VulUncs and dead eggs. ces-1(n703) is dominant. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are Ces and segregate Ces, UncVul and dead eggs. ces-1(n703) is dominant. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are Ces and segregate VulUnc and dead eggs. ces-1(n703) is dominant. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are Ces and throw dead eggs and Unc Vuls. ces-1(n703) is dominant. Well balanced. Do not distribute this strain; other labs should request it from the CGC.