Strain Information
| Name | JH3180 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | nos-2(ax2033) II. |
| Description | Maintain at 20C. ax2033 was produced by replacing +16 to +42 with TCGACTCTCGAACGATCGTAATAG in the first exon of nos-2. ax2033 mutants are sterile when fed nos-1 dsRNA. Reference: Paix A, et al. Genetics. 2014 Sep 23. |
| Mutagen | CRISPR-Cas9 |
| Outcrossed | x0 |
| Made by | Chih-Yung Lee |
| Laboratory | JH |
Sign in
or
register an account if you want to order this strain.