Strain Information

Name JH3180   View On Wormbase
Species C. elegans
Genotypenos-2(ax2033) II.
DescriptionMaintain at 20C. ax2033 was produced by replacing +16 to +42 with TCGACTCTCGAACGATCGTAATAG in the first exon of nos-2. ax2033 mutants are sterile when fed nos-1 dsRNA. Reference: Paix A, et al. Genetics. 2014 Sep 23.
MutagenCRISPR-Cas9
Outcrossedx0
Made byChih-Yung Lee
Laboratory JH
Sign in or register an account if you want to order this strain.