Search Strains

Caenorhabditis elegans wild isolate. Isolated from soil under a Kiwi fruit tree in a botanical garden in Wuhan City, Hubei Province, China, on Nov 11, 2010. Lat: 30° 32' 34.40" N; Lon: 114° 25' 11.38" E. This strain was whole-genome sequenced as part of the Million Mutation Project (MMP). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. smn-1 heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP rt248 homozygotes (larval arrest). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. NOTE: myo-2p::RFP is not visible in this strain. rt248 is a 8 bp deletion in smn-1. [rt248: TTTTGATTAGC--------ATCCCAAAC] [wild-type: TTTTGATTAGCTCCGTATCATCCCAAAC] Reference: Dimitriadi M, et al. Proc Natl Acad Sci U S A. 2016 Jul 26;113(30):E4377-86. O'Hern PJ, et al. Elife. 2017 May 2;6. pii: e20752.

rtSi10 [smn-1p::smn-1 + Cbr-unc-119(+)] IV. nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. rtSi10 transgene partially rescues smn-1(ok355): smn-1 homozygotes normally arrest as larvae, but somatic defects, including late larval lethality, are ameliorated by rtSi10. Sterility in smn-1(ok355) homozygotes is not rescued by rtSi10. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok355 homozygotes (sterile due to partial rescue by rtSi10). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: O'Hern PJ, et al. eLife 2017;6:e20752 doi: 10.7554/eLife.20752

Superficially wild-type. This is the appropriate control strain for FUS disease models HA2846 and HA2847. This control strain contains presumably silent edits inserted by CRISPR editing while creating the FUS disease models in HA2846 and HA2847, and was back-crossed to remove the pha-1 allele used in strain construction. Reference: Baskoylu S, et al. bioRxiv 799932; doi: https://doi.org/10.1101/799932

fust-1(rt256[R446S]) was created by CRISPR editing of arginine codon in C. elegans fust-1 to create FUS disease model for human mutation R524S. This strain also contains additional silent edits (also present in control strain HA2845), and was back-crossed to remove the pha-1 allele used in strain construction. Under normal culture conditions HA2846 animals are superficially wild-type; after stress latent defects are observed. Reference: Baskoylu S, et al. bioRxiv 799932; doi: https://doi.org/10.1101/799932

fust-1(rt257[P447L]) was created by CRISPR editing of proline codon in C. elegans fust-1 to create FUS disease model for human mutation P525L. This strain also contains additional silent edits (also present in control strain HA2845), and was back-crossed to remove the pha-1 allele used in strain construction. Under normal culture conditions HA2847 animals are superficially wild-type; after stress latent defects are observed. Reference: Baskoylu S, et al. bioRxiv 799932; doi: https://doi.org/10.1101/799932

rtIs11 [osm-10p::GFP + osm-10p::HtnQ150 + dpy-20(+)]. osm-10 promoter drives expression of both GFP and Htn-Q150 strongly in ASH and more weakly in other neurons of the head and tail. pqe-1(rt13) accelerates Htn-Q150 induced toxicity resulting in ASH neuron cell death predominantly during larval stages. Hence, many adult animals will lack overt GFP expression in ASH neurons. rtEx377 in the original HA759 was selected against leaving only rtIs11 in the strain available at the CGC.

Temperature sensitive embryonic lethal mutation with defects in centration and rotation of the centrosome pronuclear complex in the first cell division. Maintain at 15C.

hwSi3 [pie-1p::GFP::mex-3::pie-1 3'UTR + unc-119(+)] II. Worms are healthiest at 15C. Shift to 25C overnight to increase brightness of GFP. Mos1-mediated single-copy insertion (MosSCI) into EG4322. GFP-tagged transgene expressing full-length MEX-3 uniformly throughout oocytes and early embryos through the 4-cell stage. GFP::MEX-3 then mirrors endogenous MEX-3, disappearing from somatic cells by about the 12-cell stage. Also detected in P granules. GFP::MEX-3 can replace endogenous MEX-3. Reference: Huang NN & Hunter CP. Gene. 2015 Jan 10;554(2):160-73.

hwSi8 [pie-1p::GFP::mex-3(601-1248)::pie-1 3'UTR + unc-119(+)] II. Worms are healthiest at 15C. Shift to 25C overnight to increase brightness of GFP. Mos1-mediated single-copy insertion (MosSCI) into EG4322. GFP-tagged transgene expressing a portion of MEX-3(601-1248) required for protein degradation. At about the 12-cell stage, soma-germline asymmetry is briefly visible before GFP::MEX-3(601-1248) becomes undetectable even in the germline blastomeres. Detected weakly on P granules only in the presence of endogenous MEX. Reference: Huang NN & Hunter CP. Gene. 2015 Jan 10;554(2):160-73.

hwSi13 [pie-1p::GFP::mex-3(2-636)::pie-1 3'UTR + unc-119(+)] II. Worms are healthiest at 15C. Shift to 25C overnight to increase brightness of GFP. Mos1-mediated single-copy insertion (MosSCI) into EG4322. GFP-tagged transgene expressing truncated MEX-3 that is missing a portion required for protein degradation. GFP::MEX-3(2-636) is extraordinarily stable, persisting in somatic cells through the comma stage (~550 cells) at levels similar to those in 1- and 2-cell embryos. Also detected on P granules through hatching. Reference: Huang NN & Hunter CP. Gene. 2015 Jan 10;554(2):160-73.

HG231 exhibits an approximately 20% increase in mean, median and maxium lifespans compared to N2. HG231 exhibits somewhat reduced fertility and somewhat longer development time than N2. It has a normal appearance, movements and mating behavior. It's swimming rate in liquid is slightly higher than N2. STS mapping indicates the most likely location for age-2 is on LG I.

This double mutant exhibits a doubling of both mean and maximum lifespans at 25C compared to N2. It exhibits a longer lifespan at 25C than it does at 20C. It has somewhat reduced fertility. It has normal development time, appearance, movements and feeding behavior. It's swimming rate in liquid is slightly higher than N2. STS mapping indicates the most likely location for age-2 is on LG I.

C. briggsae wild type strain collected from Okayama, Japan. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

C. briggsae wild type strain collected in Sendai, Japan. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Superficially wild-type except for a slightly shorter body length in adults. Crispr/Cas9 was used to create a 13 bp deletion in exon7 of ccar-1a; breakpoints: CTGATTCGGGAG/sda11/ATCGGAAGTTTC. sda11 is an isoform-specific deletion allele. It only affects the function of CCAR-1A and CCAR-1D, but not CCAR-1B and C. In addition, because CCAR-1D is not expressed in embryos,this allele can be used to specifically inactivate CCAR-1A (the full-length isoform that is the most similar to human CCAR1) during embryogenesis. Reference: Fu R, et al. J Cell Sci. 2018 May 10.

Caenorhabditis sp. 77 wild isolate. Male-female. Maintain at 20C or warmer. Elegans group. Isofemale line isolated from rotting banana flowers collected in a forest near Batu, East Java, Indonesia, on 28 Apr 2024. GPS -7.803387, 112.516604. Reference: Devi, et al. G3 (Bethesda). 2025 Aug 6;15(8):jkaf134. doi: 10.1093/g3journal/jkaf134. PMID: 40542721.

Caenorhabditis sp. 79 wild isolate. Male-female. Maintain at 20C or warmer. Elegans group. Isofemale line isolated from leaf litter collected in a forest near Jeneberang River Lake, Parangloe, South Sulawesi, Indonesia, on 6 May 2024. GPS -5.238297, 119.642281. Reference: Devi, et al. G3 (Bethesda). 2025 Aug 6;15(8):jkaf134. doi: 10.1093/g3journal/jkaf134. PMID: 40542721.

Caenorhabditis sp. 81 wild isolate. Male-female. Maintain at 20C or warmer. Elegans group. Isofemale line isolated from rotting Brugmansia flowers collected in a forest near Batu, East Java, Indonesia, on 28 Apr 2024. GPS -7.805005, 112.516905. Reference: Devi, et al. G3 (Bethesda). 2025 Aug 6;15(8):jkaf134. doi: 10.1093/g3journal/jkaf134. PMID: 40542721.

Caenorhabditis sp. 80 wild isolate. Male-female. Maintain at 20C or warmer. Elegans group. Isofemale line isolated from rotting wild Musa pseudostems collected in the forest on the road between Bromo and Malang, East Java, Indonesia, on 11 May 2024. GPS -7.99746, 112.87387. Reference: Devi, et al. G3 (Bethesda). 2025 Aug 6;15(8):jkaf134. doi: 10.1093/g3journal/jkaf134. PMID: 40542721.

Dominant ts maternal-effect embryonic lethal. Embryos arrest prior to morphogenesis or at two-fold. Non-ts recessive mid-larval lethal. Maintain at 15C. Freezes poorly.

Dominant ts maternal-effect embryonic lethal. Embryos show extensive cytoplasmic blebbing, often accompanied by small spindles and incomplete cytokinesis. Two cell embryos divide synchronously. Embryos arrest with eight to several hundred cells. Recessive non-ts maternal-effect embryonic lethal. Null may be WT. Maintain at 15C.

sbEx136 [(pAW33.1) let-502p::GFP + rol-6(su1006)]. pAW33.1 is about 6.6 kb BamH1 fragment from K06G1 and includes the first 12 amino acids of LET-502 clones into pPD95.67/BamH1. Should be nuclear localized, but is not nuclear localized. Maintain by picking Rollers.

osEx211[apr-1::GFP + unc-76(+)]. This strain expresses functional APR-1::GFP driven by the apr-1 promoter. In the seam cells, just prior to the onset of mitosis, APR-1::GFP localizes to the anterior cortex.

osEx219 [pbrm-1::GFP + unc-76(+)]. Pick wild-type to maintain. GFP expression in most somatic nuclei. Reference: Shibata Y, et al. Dev Biol. 2012 Jan 15;361(2):349-57.

osEx229 [pry-1::GFP + unc-76(+)]. This strain expresses functional pry-1::GFP driven by the pry-1 promoter. In the seam cells, just prior to the onset of mitosis, pry-1::GFP localizes to the anterior cortex.

osIs1 [CYE-1::GFP (pMF101) + unc-76(+)]; probably integrated on LG II. This strain has Ste, Emb, Muv, Him phenotypes (probably dominant effects of the integration). Expression in many blast cells can be detected. Reference: Fujita et al. PLoS ONE 2, e407 (2007).

osIs2 [CYE-1::GFP (pMF101) + unc-76(+)]; probably integrated on LG X. No dominant phenotypes observed (see HS1337). Expression in many blast cells can be detected, but much weaker than osIs1. Reference: Fujita et al. PLoS ONE 2, e407 (2007).

osEx240 [bet-1p::bet-1::GFP + unc-76(+)]. Pick Wild-type (non-Unc) to maintain. GFP expression in most somatic cells. Reference: Shibata Y, et al. Development. 2010 Apr;137(7):1045-53.

Egl, Pvul, Psa (Phasmid Socket Absent) and some embryonic lethality. The T cell division can be symmetric as in lin-17 mutants. Less severe at 15C. swsn-4 encodes a homolog of yeast SW12, a component of the SWI/SNF complex.

wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Heterozygotes are GFP+(pharynx) wild-type and segregate GFP+(pharynx) wild-type, GFP-(pharynx) Sys Psa Unc and dead eggs. PIck GFP+(pharynx) wild-type to maintain. Presence of cfz-2 was confirmed by PCR; mig-1 by complementation test. Reference: Yamamoto Y, et al. PLoS Genet. 2011 Oct;7(10):e1002308.

Temperature sensitive. At 22.5C, maternal effect embryonic lethal. Temperature shift-up to 22.5C during embryogenesis results in animals with Egl, Pvul and Psa (phasmid socket absent) phenotypes. Shift-up to 25C results in growth arrest at larval stage. The T cell division can be symmetric as in lin-17 mutants. At 15C, nearly WT. Males grown at 15C can mate very well. psa-1 encodes a homolog of yeast SW13, a component of the SWI/SNF complex. Sequence data of this strain revealed the mutation is actually GTC/CCC/TCA to GTC/CTC/TCA causing a P86L substitution (G. Hayes).

osEx89 [col-10::GFP + dpy-22(+)]. Animals with the array are non-Dpy and GFP+. Animals which have lost the array are Dpy, Egl, and GFP-.

osEx89 [col-10::GFP + dpy-22(+)]. Animals with the array are non-Dpy and GFP+. Animals which have lost the array are Dpy, Egl, and GFP-.

Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm514 homozygotes (probable embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain.

osEx138 [let-526::GFP + rol-6(su1006)]. Rollers. Pick rollers to maintain. GFP expression in most somatic nuclei. Reference: Shibata Y, et al. Dev Biol. 2012 Jan 15;361(2):349-57.

osEx158 [wrm-1::GFP + unc-76(+)]. Animals with the array are WT and GFP+. Animals which have lost the array are Unc and GFP-.

Bacteria. Genotype: F-, mcrA, mcrB, IN(rrnD-rrnE)1, rnc14::Tn10(DE3 lysogen: lacUV5 promoter -T7 polymerase) (IPTG-inducible T7 polymerase) (RNAse III minus). This strain grows on LB or 2XYT plates. This strain is tetracycline resistant. Researchers using this strain should test for expression by transforming in one of the plasmids from the Fire Vector Kit (1999) (pLT76, e.g.) using standard CaCl2 transformation techniques. Biosafety Level: BSL-1.

Egg-laying (Egl) defects and subsequent internal hatching of progeny (Bagging) in > 95% of animals. xe11 is a C-to-U point mutation in each of the endogenous let-7 complementary sites, LCS1 and LCS2 [I:C9,335,211T & I:C9,335,260T]. xe11 is a weak gain-of-function allele: mutation of two functionally relevant let-7 binding sites impairs repression by let-7 causing over-expression of LIN-41 in L4 stage animals. Reference: Ecsedi M, et al. Dev Cell. 2015 Feb 9;32(3):335-44. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Low penetrance Pvl (i.e., tagged protein appears not fully functional). CRISPR/Cas9-engineered allele adds GFP and 3xflag tag to LIN-29. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Aeschimann F, et al., Mol Cell. 2017 Feb 2;65(3):476-489.

Superficially wild-type. CRISPR/Cas9-engineered allele adds GFP and 3xflag tag to the N-terminus of LIN-29A. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Aeschimann F, et al., (2019). A single let-7 target to coordinate transition to adulthood. Life Science Alliance 2, e201900335. http://dx.doi.org/10.26508/lsa.201900335 )

Partially penetrant Pvl and Egl. xe40 specifically disrupts the LIN-29A isoform. The GFP tag was inserted at the shared C-terminus of LIN-29A/B in the xe40 background, so only the labeled B isoform is expressed. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Pereira et al., (2019) Timing mechanism of sexually dimorphic nervous system differentiation. eLIFE 8: e42078. https://doi.org/10.7554/eLife.42078

Pick GFP+ Egl to maintain. Segregates GFP- lin-41(xe8) homozygotes (die by vulval bursting as young adults), lin-41(xe8)/lin-41(bch28[eft-3p::gfp::h2b::tbb-2 3'UTR] xe70) heterozygotes (GFP+ Egl), and lin-41(bch28[eft-3p::gfp::h2b::tbb-2 3'UTR] xe70) (GFP+ Ste Dpy). lin-41(xe8) is a deletion of let-7 binding sites in the lin-41 3'UTR. The balancer was derived from lin-41(bch28), a lin-41(0) allele in which an expression cassette that drives ubiquitous nuclear GFP from the eft-3 promoter has been inserted into the lin-41 coding sequence (Katic et al., G3 (2015) 5:1649-56). References: Katic et al., G3 (2015) 5:1649-56 for lin-41(bch28) starting allele for balancer generation. Aeschimann F, et al. (2019). A single let-7 target to coordinate transition to adulthood. Life Science Alliance 2, e201900335. for balanced line. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

bpIs131 [sepa-1p::sepa-1::GFP + unc-76(+)]. Him. SEPA-1::GFP aggregates form in a temporal pattern. Diffuse SEPA-1::GFP is detectible in most cells at the comma stage and greatly diminished by the 2-fold stage. After hatching, cytoplasmic SEPA-1::GFP aggregates were found in a few unidentified cells in the head and tail regions and also in the intestine, especially in the anterior and posterior pairs of intestine cells. Reference: Tian Y, et al. Cell. 2010 Jun 11;141(6):1042-55.

bpIs151 [sqst-1p::sqst-1::GFP + unc-76(+)]. Him. In wild-type embryos, sqst-1::GFP is very weakly expressed and diffusely localized in the cytoplasm. Reference: Tian Y, et al. Cell. 2010 Jun 11;141(6):1042-55.

bpIs151 [sqst-1p::sqst-1::GFP + unc-76(+)]. bp399 mutants accumulate SQST-1 aggregates strictly in the intestine in a distinct temporal pattern. SQST-1::GFP aggregates are absent in bp399 embryos, but start to form in L1 larvae and increase in number and size throughout larval development. Reference: Guo B, et al. EMBO Rep. 2014 Jun;15(6):705-13.

quEx168 [sax-3::GFP + odr-1::RFP]. Pick RFP+ to maintain. GFP is visible at higher magnification but fades quickly. Strongest GFP is in the head region. The Chin-Sang Lab recommends researchers use this strain instead of IC450, as sax-3::GFP expression in IC699 is more consistent than in the comparable strain IC450.

Healthy and fertile but exhibit a lowly penetrant lethality, and a small but significant proportion of the mutants arrest as early larvae. Reference: Pujol N, et al. Curr Biol. 2001 Jun 5;11(11):809-21.

Strain derived by outcrossing RB1547 two times to N2 to remove the lethal background mutation in RB1547. Reference: Dierking K, et al. Cell Host Microbe. 2011 May 19;9(5):425-35.

Maintain at 15C. At 25C, nr2013 homozygotes are not viable. At 15C, less than 10% of nr2013 homozygotes develop into adults that are marginally fertile, while the majority of worms arrest at different developmental stages and exhibit dramatic defects in morphogenesis. Reference: Pujol N, et al. Curr Biol. 2001 Jun 5;11(11):809-21.