BX17 |
C. elegans |
fat-4(wa14) IV. Show Description
No delta5 fatty acid desaturase activity.
|
|
CT16 |
C. elegans |
zaEx17. Show Description
zaEx17 [lin-4::GFP + rol-6(su1006)]. Pick GFP+ to maintain. The GFP+ animals may not always express the Roller phenotype.
|
|
KX17 |
C. elegans |
ife-4(ok320) X. Show Description
C05D9.5 Homozygous. Deletion of 1778 bp removes 1088 bp upstream of start codon and all of exons 1 and 2. IFE-4 is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint determined by BDK is CATCGAGTCGGGACGTGATG/AGTAGTGCAAGACTGATAAA. Eukaryotic translation initiation factor 4E gene (isoform 4).
|
|
SAL139 |
C. elegans |
pha-1(e2123) III; denEx17. Show Description
denEx17 [dod-22::GFP + pha-1(+)]. Maintain at >22 degrees. Reference: Alper S, et al. (2007) Mol Cell Biol 27:5544-53.
|
|
TH202 |
C. elegans |
unc-119(ed3) III; ddEx17. Show Description
ddEx17 [glh-1::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. Pick wild-type to maintain array. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
|
|
ZZ17 |
C. elegans |
lev-10(x17) I. Show Description
Pseudo wild type levamisole resistant. WT phenotype. pka lev-10.
|
|
AX1789 |
C. elegans |
dbEx719. Show Description
dbEx719 [npr-5::mCherry + unc-122p::GFP]. Pick GFP+ to maintain. mCherry expression in a subset of amphid neurons (ADF, ASE, ASG, ASI, ASJ, ASK, AWA, AWB), in the inner labial neuron IL2, in the interneurons AIA and AUA, and in the phasmids (PHA, PHB). Expression was also seen in head, neck, and body wall muscles. Reference: Cohen M, et al. 2009 Cell Metabolism 9: 375-385.
|
|
AX1791 |
C. elegans |
npr-5(ok1583) V; dbEx720. Show Description
dbEx720 [npr-5::npr-5(cDNA) + unc-122p::GFP]. Pick GFP+ to maintain. Intestinal fat accumulation is similar to wild-type. Reference: Cohen M, et al. 2009 Cell Metabolism 9: 375-385.
|
|
AX1792 |
C. elegans |
dbEx721. Show Description
dbEx721 [npr-4::mCherry + unc-122p::GFP]. Pick GFP+ to maintain. mCherry expression in the AVA and RIV neurons, possibly in BAG, in the tail neuron PQR, and in the BDU neurons. Expression was also seen in the coelomocytes, the intestine, and the rectal gland cells. Reference: Cohen M, et al. 2009 Cell Metabolism 9: 375-385.
|
|
AX7884 |
C. elegans |
pod-2(syb1772[pod-2::His10]) II; mccc-1(syb1666[mccc-1::His10]) IV; pyc-1(syb1680[pyc-1::His10]) V; pcca-1(syb1626[pcca-1::His10]) X. Show Description
Superficially wild-type. Referred to as MP3-His. Strain can be used to biotinylated carboxylases from worm extracts. AX7884 obtained by crossing parental strains PHX1772 pod-2(syb1772[pod-2::His10]) II, PHX1666 mccc-1(syb1666[mccc-1::His10]) IV, PHX1680 pyc-1(syb1680[pyc-1::His10]) V and PHX1626 pcca-1(syb1626[pcca-1::His10]) X to obtain the quadruple His10-tagged strain. The 5xGlycine(G-linker)-His10 tag is a 45 bp sequence (GGAGGAGGAGGAGGACACCATCACCATCACCACCACCACCACCAC)
encoding five glycine as a linker and ten histidine residues was knocked in at the C terminus-just upstream of the termination codon-of each of the four carboxylases.
Reference: Artan M, et al. J Biol Chem. 2022 Aug 3:102343. doi: 10.1016/j.jbc.2022.102343. Epub ahead of print. PMID: 35933017.
|
|
AY172 |
C. elegans |
mrp-1(pk89) X; acEx172. Show Description
acEx172 [mrp-1p::mrp-1C::SL2::GFP + unc-122p::RFP]. Pick GFP+ or RFP+ animals to maintain. mrp-1C (isoform C from cDNA) expressed under its own promoter rescues mrp-1. Reference: Lalsiamthara J & Aballay A. Commun Biol. 2022 May 5;5(1):422. doi: 10.1038/s42003-022-03381-1. PMID: 35513700.
|
|
AY173 |
C. elegans |
mrp-1(pk89) X; acEx173. Show Description
acEx173 [mrp-1::GFP]. Pick GFP+ animals to maintain. Translationally fused MRP-1::GFP expressed under its own promoter rescues mrp-1. Reference: Lalsiamthara J & Aballay A. Commun Biol. 2022 May 5;5(1):422. doi: 10.1038/s42003-022-03381-1. PMID: 35513700.
|
|
AY174 |
C. elegans |
mrp-1(pk89) X; acEx174. Show Description
acEx174 [ges-1p::mrp-1::GFP + unc-122p::RFP]. Pick GFP+ or RFP+ animals to maintain. Translational fusion of MRP-1::GFP driven by intestine-specific ges-1 promoter. Reference: Lalsiamthara J & Aballay A. Commun Biol. 2022 May 5;5(1):422. doi: 10.1038/s42003-022-03381-1. PMID: 35513700.
|
|
AY175 |
C. elegans |
nmr-1(ak4) II; acEx175. Show Description
acEx175 [glr-1p::nmr-1::SL2::GFP + unc-122p::RFP]. Pick GFP+ or RFP+ animals to maintain. glr-1 promoter drives NMR-1 expression primarily in interneuron, neurons, and ventral nerve cord. Reference: Lalsiamthara J & Aballay A. Commun Biol. 2022 May 5;5(1):422. doi: 10.1038/s42003-022-03381-1. PMID: 35513700.
|
|
AY176 |
C. elegans |
nmr-1(ak4) II; acEx176. Show Description
acEx176 [dc-1p::nmr-1::SL2::GFP + unc-122p::RFP]. Pick GFP+ or RFP+ animals to maintain. tdc-1 promoter drives NMR-1 expression primarily in RIM interneurons. Reference: Lalsiamthara J & Aballay A. Commun Biol. 2022 May 5;5(1):422. doi: 10.1038/s42003-022-03381-1. PMID: 35513700.
|
|
AY177 |
C. elegans |
acEx177. Show Description
acEx177 [ges-1p::mrp-1::GFP + vha-6::DsRed + unc-122p::RFP]. Pick RFP+ to maintain. Translationally fused MRP-1::GFP expressed under intestinal specific ges-1 promoter, MRP-1::GFP proteins localize at the basolateral membrane of the intestine. Translationally fused VHA-6::RFP expressed under its own promoter, VHA-6::RFP proteins localize at the lumen or luminal membrane of the intestine. For better results, observe fluorescence signals on the L4 stage animals and also under higher magnification microscopy. Reference: Lalsiamthara J & Aballay A. Commun Biol. 2022 May 5;5(1):422. doi: 10.1038/s42003-022-03381-1. PMID: 35513700.
|
|
AY178 |
C. elegans |
ynIs78; acEx178. Show Description
ynIs78 [flp-8p::GFP]. acEx178 [flp-8p::ced-3 (p15)::nz + flp-32::cz::ced-3 (p17) + unc-122p::RFP]. AUA interneurons ablated in flp-8p::GFP background. GFP-labelled AUA neurons are missing in the neuronal ablated animals. Pick RFP+ animals to maintain. Reference: Filipowicz A, et al. BMC Biol. 2022 Oct 8;20(1):229. doi: 10.1186/s12915-022-01424-x. PMID: 36209082.
|
|
AY179 |
C. elegans |
ynIs87; acEx179. Show Description
ynIs78 [flp-8p::GFP]. acEx179 [flp-21p::ced-3 (p15)::nz + ncs-1p::cz::ced-3 (p17) + unc-122p::RFP]. RMG interneurons ablated in flp-21p::GFP background. GFP-labelled RMG neurons are missing in the neuronal ablated animals. Pick RFP+ animals to maintain. Reference: Filipowicz A, et al. BMC Biol. 2022 Oct 8;20(1):229. doi: 10.1186/s12915-022-01424-x. PMID: 36209082.
|
|
BC17009 |
C. elegans |
dpy-5(e907) I; sEx17009. Show Description
sEx17009 [rCesT13F2.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC17132 |
C. elegans |
dpy-5(e907) I; sEx17132. Show Description
sEx17132 [rCesC39E6.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC17322 |
C. elegans |
dpy-5(e907) I; sEx17322. Show Description
sEx17322 contains [rCesZC373.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC17441 |
C. elegans |
dpy-5(e907) I; sEx17441. Show Description
sEx17441 [rCes F58E10.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC17993 |
C. elegans |
dpy-5(e907) I; sEx17993. Show Description
sEx17993 contains [rCesC17E4.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC4970 |
C. elegans |
sEx170. Show Description
sEx170 [ZC155 (III) + pCes1943[rol-6(su1006)]]. 20 ng/ul ZC155 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC4971 |
C. elegans |
sEx171. Show Description
sEx171 [T26A5 (III) + pCes1943[rol-6(su1006)]]. segrgnt 1. 10 ng/ul T26A5 + 90 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BP387 |
C. elegans |
hyEx173. Show Description
hyEx173 [hsp16-2::aff-1 + ajm-1::GFP + rol-6(su1006)]. Pick Rollers to maintain. Rollers are GFP+.
|
|
BR8551 |
C.elegans |
endu-2(tm4977) X; byEx1795. Show Description
byEx1795 [unc-119p::endu-2::eGFP::3xFlag + rol-6(su1006)]. Pick Rollers to maintain. Transgene provides neuronal rescue of endu-2(tm4977) that also rescues mortal germline (Mrt) phenotype. Reference: Qi W, et al. (2020) A secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. BioRxiv. doi: 10.1101/2020.12.04.408260. Accepted by Nature Communications.
|
|
CF1449 |
C. elegans |
daf-16(mu86) I; daf-2(e1370) III; muEx176. Show Description
muEx176 [daf-16p::GFP::daf-16 + rol-6(su1006)]. Pick rollers to maintain -- Low transmission rate! Maintain at 15C. Forms dauers at 25C. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.
|
|
CG490 |
C. elegans |
unc-103(n1213) III; egl-2(rg4) him-5(e1490) V; rgEx173. Show Description
rgEx173 [unc-103ep::egl-2(cDNA) + gtl-1p::CFP]. Pick animals with cyan fluorescence in their intestines. rgEx173 rescues food deprivation's ability to suppress unc-103(n1213)-induced male sex muscle seizures.
|
|
CG499 |
C. elegans |
daf-2(e1368) unc-103(n1213) III; him-5(e1490) V; rgEx178. Show Description
rgEx178 [lev-11p::daf-2(+) + lev-11p::GFP]. rgEx178 rescues food deprivation suppression of unc-103(n1213)-induced spicule protraction.
|
|
CX17256 |
C. elegans |
kyIs722. Show Description
kyIs722 [str-2p::GCaMP5(D380Y) + elt-2::mCherry]. GCaMP5a expression driven by str-2 promoter, providing a very bright integrated calcium indicator useful for imaging of AWC(on).
|
|
DA1750 |
C. elegans |
adEx1750. Show Description
adEx1750 [pmk-3::GFP + rol-6(su1006)]. Pick Rollers to maintain. Nuclear GFP in anterior and posterior intestine. [NOTE: adEx1750 contains a F42G8.4::GFP reporter construct. This array had been previously described as carrying a pmk-1::GFP reporter; the description of the array was updated in CGC records ~2016. islo-1, pmk-3, pmk-2, and pmk-1 are in an operon. The order of genes was described in Berman et al. as [pmk-1(F42G8.4)->pmk-2(F42G8.3)->pmk-3(B0218.3)], but the official WormBase gene names were assigned in reverse order [pmk-1(B0218.3)->pmk-2(F42G8.3)->pmk-3(F42G8.4)]. See Berman K, et al. Mol Cell Biol Res Commun. 2001 Nov;4(6):337-44. PMID: 11703092 for additional information.]
|
|
DM7172 |
C. elegans |
raEx172. Show Description
raEx172 [T05G5.1p::F53E2.1 ORF(cDNA)::GFP + rol-6(su1006)]. Wild-type background with extrachromosomal array carrying dominant rol-6 and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Maintain by picking Rol-6 animals. WBPaper00038444.
|
|
DM7174 |
C. elegans |
raEx174. Show Description
raEx174 [T05G5.1p::T27A1.4 ORF(cDNA)::GFP + rol-6(su1006)]. Wild-type background with extrachromosomal array carrying dominant rol-6 and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Maintain by picking Rol-6 animals. WBPaper00038444.
|
|
DM7176 |
C. elegans |
raEx176. Show Description
raEx176 [T05G5.1p::Y39A1C.1 ORF(cDNA)::GFP + rol-6(su1006)]. Wild-type background with extrachromosomal array carrying dominant rol-6 and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Maintain by picking Rol-6 animals. WBPaper00038444.
|
|
DM7177 |
C. elegans |
pha-1(e2123) III; raEx177. Show Description
raEx177 [T05G5.1p::T20D3.8(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
DM7179 |
C. elegans |
pha-1(e2123) III; raEx179. Show Description
raEx179 [T05G5.1p::F01G4.5(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
EG7804 |
C. elegans |
unc-119(ed3) III; oxTi173 V; oxEx1795. Show Description
oxTi173 [unc-18(+) + ttTi5605 NeoR] V. oxEx1795 [Cbr-unc-119(+)]. Pick wild-type to maintain. oxTi173 is a Mini-Mos insertion of ttTi5605 MosSCI landing site in a repressive region at position 17,523,246 of Chr V; can be used with standard ttTi5605 MosSCI targeting vectors. Animals carrying the array are wild-type and segregate Unc animals that can be used for MosSCI injections. This strain carries a rescuing unc-119(+) array for easier maintenance; inject Unc-119 animals that have lost the array. Reference: Froekjaer-Jensen et al. Cell (2016).
|
|
FX17650 |
C. elegans |
lin-1(tm5929)/tmIn1 IV. Show Description
Homozygous lethal or sterile deletion allele balanced by Unc-marked translocation. Break points: In(egl-4 unc-17) IV. Covered region (Mb) 1.8 (1.8..3.6) Unc. Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.
|
|
FX17788 |
C. elegans |
mlt-7(tm1794)/tmIn4 II. Show Description
Heterozygotes are slightly Dpy, and segregate slightly Dpy mlt-7/tmIn4 heterozygotes, Dpy tmIn4 homozygotes, and mlt-7(tm1794) homozygotes (Let). Break points: In(lin-8 dpy-2) II. Covered region (Mb) 3.7 (3.1..6.7) Dpy. Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.
|
|
JIM173 |
C. elegans |
unc-119(tm4063) III; ujEx173. Show Description
ujEx173 [ceh-36::TY1::EGFP::3xFLAG + unc-119(+)]. Pick non-Unc to maintain. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.
|
|
JIM220 |
C. elegans |
ujIs113 II; unc-30(ok613) IV; ceh-36(ok795) X; ujEx173. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujEx173 [ceh-36::TY1::eGFP::3xFLAG + unc-119(+)]. ujEx173 rescues unc-36, suppressing synthetic lethality in animals carrying the array. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.
|
|
NC1750 |
C. elegans |
hdIs32 III; gvEx173. Show Description
hdIs32 [glr-1::DsRed2]. gvEx173 [opt-3::GFP + rol-6(su1006)]. Maintain by picking Rollers, which should be GFP+. hdIs32 might be prone to silencing.
|
|
NL361 |
C. elegans |
gpb-1(pk44) II; pkEx170. Show Description
pkEx170 [gpb-1(+) + rol-6(su1006)]. Rollers. Pick Rollers to maintain. NL361 is homozygous for the gpb-1 deletion allele pk44; this results in an L1 arrest if the larvae has maternally derived GPB-1 or in an early embryonic lethality if there is no maternally derived GPB-1 for the developing embryo. This phenotype is rescued by the extrachromosomal transgene which contains the WT gpb-1 gene.
|
|
NW1644 |
C. elegans |
evEx170. Show Description
evEx170 [smp-1::GFP(pVGS1a::GFP) + rol-6(su1006)]. Maintain by picking Rollers. GFP expression in muscle, neuron, vuvlal cells and male ray cells.
|
|
OH2984 |
C. elegans |
otEx1765. Show Description
otEx1765 [let-765::GFP + rol-6(su1006)]. Maintain by picking Rollers.
|
|
OH2985 |
C. elegans |
otEx1766. Show Description
otEx1766 [let-765::GFP + rol-6(su1006)]. Maintain by picking Rollers.
|
|
OH2987 |
C. elegans |
otEx1768. Show Description
otEx1768 [let-756::GFP + dpy-7::RFP + rol-6(su1006)]. Maintain by picking Rollers.
|
|
OH2990 |
C. elegans |
otEx1771. Show Description
otEx1771[egl-15::GFP + dpy-7::RFP + rol-6(su1006)]. Maintain by picking Rollers.
|
|
OH2996 |
C. elegans |
ntIs1; lsy-2(ot64) X; otEx1777. Show Description
ntIs1 [gcy-5p::GFP + lin-15(+)] V. otEx1777 [lsy-2::GFP + rol-6(su1006)]. Maintain by picking Rollers.
|
|