Search Strains

More Fields
Strain Species Genotype Add
UDN100161 C. elegans pph-5(udn91) V. Show Description
pph-5 [A48T] #2 variant edit from Fielder, et al. (2022). Includes addition of silent AvaII restriction site and silent PAM ablation. Homozygous viable and superficially wild-type. Genotype using primers Forward: accggaaattgtcccaaaat, Reverse: tttccgactttctggaggtg. Digest with AvaII restriction enzyme for resulting sizes of 401bp +403bp. Wild-type product will not be digested.
UDN100163 C. elegans pph-5(udn93) V. Show Description
pph-5 [A48A] #1 control edit for strain UDN100160 from Fielder, et al. (2022). Wild-type sequence except for addition of silent AvaII restriction site and silent PAM ablation. Homozygous viable and wild-type appearance. Genotype using primers Forward: accggaaattgtcccaaaat, Reverse: tttccgactttctggaggtg. Digest with AvaII restriction enzyme for resulting sizes of 401bp +403bp. Wild-type product will not be digested.
UDN100169 C. elegans unc-116(gk5722udn86)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+ (qC1 homozygotes), and non-GFP gk5722udn86 homozygotes (larval arrest; few escapers). Derived from VC4653; selection cassette in VC4653 was removed, and then crossed with qC1 nIs189 [myo-2::GFP] balancer. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1.
UDN100194 C. elegans popl-5(udn113)/tmC29 [unc-49(tmIs1259)] III. Show Description
popl-5 [S99I]/tmC29 III. Variant edit. Lethal mutation balanced by tmC29. Balancer marked with myo-2p::GFP. Heterozygotes are WT with pharyngeal GFP, and segregate GFP+ heterozygotes, non-GFP popl-5 [S99I] homozygotes (larval lethal), and Unc GFP+ tmC29 homozygotes. Pick fertile wild-type GFP+ to maintain. NOTE: udn113 homozygotes are partially L3 larval lethal: some homozygotes can develop into sterile adults with protruding vulvae. Pick fertile GFP+ to maintain. AvaII site added in S99I allele for ease of genotyping. Reference: Huang et al. 2022. PMID: 35121658
UDN100215 C. elegans popl-5(udn109)/tmC29 [unc-49(tmIs1259)] III. Show Description
popl-5 [S99S]/tmC29 III. Control edit mutation maintained over tmC29. Balancer marked with myo-2p::GFP. Heterozygotes are WT with pharyngeal GFP, and segregate GFP+ heterozygotes, non-GFP popl-5 [S99S] homozygotes (viable and fertile), and Unc GFP+ tmC29 homozygotes. Pick fertile wild-type GFP+ to maintain. NOTE: udn109 is essentially wild-type. Pick GFP+ to prevent non-GFP popl-5 [S99S] homozygotes from taking over the population and losing the balancer! Silent AvaII site added in S99S allele for ease of genotyping. Reference: Huang et al. 2022. PMID: 35121658
UJ2587 C. elegans elks-1(miz365[elks-1::7xGFP11]) IV. Show Description
7xGFP11 tag inserted into endogenous elks-1 locus. ELKS-1::7xGFP localizes to tip of synapses similar to CLA-1. miz365 genotyping primers: F: TACCGGCTCCAGTGATTCC / R: tgtgtgccattggatgtgag (wt = 203bp, mutant = 676bp). Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.
UJ3103 C. elegans sng-1(miz488[sng-1::4xmScarlet11]) X; mizIs41. Show Description
mizIs41 [mig-13p::mScarlet1-10::SL2::GFP1-10 + odr-1p::GFP]. 4xmScarlet11 tag inserted into endogenous sng-1 locus. miz488 genotyping primers: F: CGCACCTCCACCTCAATCC / R: AACACAACAAGACGGAAATACG. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.
UL1423 C. elegans unc-119(ed3) III; leEx1423. Show Description
leEx1423 [mxl-2::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
UL1432 C. elegans unc-119(ed3) III; leEx1432. Show Description
leEx1432 [hlh-10::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
UL1435 C. elegans unc-119(ed3) III; leEx1435. Show Description
leEx1435 contains [hnd-1::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.
UL1439 C. elegans unc-119(ed3) III; leEx1439. Show Description
leEx1439 [mxl-3::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
UL1444 C. elegans unc-119(ed3) III; leEx1444. Show Description
leEx1444 [hlh-29::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
UL1447 C. elegans unc-119(ed3) III; leEx1447. Show Description
leEx1447 contains [hif-1::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.
UL1531 C. elegans unc-119(ed3) III; leEx1531. Show Description
leEx1531 contains [mml-1::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.
UL1533 C. elegans unc-119(ed3) III; leEx1533. Show Description
leEx1533 contains [hlh-3::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.
UL1546 C. elegans unc-119(ed3) III; leEx1546. Show Description
leEx1546 [hlh-2::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
UL1556 C. elegans unc-119(ed3) III; leEx1556. Show Description
leEx1556 contains [hlh-12::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.
UL1566 C. elegans unc-119(ed3) III; leEx1566. Show Description
leEx1566 [lin-32::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
UL1583 C. elegans unc-119(ed3) III; leEx1583. Show Description
leEx1583 contains [hlh-4::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.
UL1601 C. elegans unc-119(ed3) III; leEx1601. Show Description
leEx1601 contains [hlh-8::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.
UL1606 C. elegans unc-119(ed3) III; leEx1606. Show Description
leEx1606 contains [aha-1::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.
UL1692 C. elegans unc-119(ed3) III; leEx1692. Show Description
leEx1692 contains [hlh-34::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.
UL1709 C. elegans unc-119(ed3) III; leEx1709. Show Description
leEx1709 [ahr-1::GFP + unc-119(+)]. Superficially wild-type. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
UL1713 C. elegans unc-119(ed3) III; leEx1713. Show Description
leEx1713 [hlh-17::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
UL768 C. elegans pes-1(leDf1) IV. Show Description
No obvious altered phenotype. Deletion removes 1.9 kb from within pes-1, including more than half of the forkhead domain encoding region.
UP1153 C. elegans csEx63. Show Description
csEx63 [(pMS88) hsp16-41::torso^4021-Draf + (pTG96) sur-5::GFP]. Pick GFP+ to maintain. Muv phenotype in GFP+ after heat shock during larval stage. References: Kao G, et al. Development. 2004 Feb;131(4):755-65. Rocheleau CE, et al. Proc Natl Acad Sci U S A. 2005 Aug 16;102(33):11757-62.
UP3666 C. elegans lpr-3(cs250[ssSfGFP::lpr-3]) X?. Show Description
Endogenous lpr-3 locus tagged with ssSfGFP using CRISPR/Cas9. Superficially wild-type. Reference: Cohen JD, et al. Elife. 2020 Sep 25;9:e57874. PMID: 32975517.
UP3746 C. elegans let-653(cs262[let-653::SfGFP]) IV. Show Description
Endogenous let-653 locus tagged with SfGFP using CRISPR/Cas9. Superficially wild-type. Reference: Cohen JD, et al. Elife. 2020 Sep 25;9:e57874. PMID: 32975517.
UP3756 C. elegans let-4(cs265[ssmCherry::let-4]) X. Show Description
Endogenous let-4 locus tagged with mCherry using CRISPR/Cas9. mCherry expression is faint. Superficially wild-type. Reference: Cohen JD, et al. Elife. 2020 Sep 25;9:e57874. PMID: 32975517.
UP749 C. elegans ksr-2(dx27) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Segregates WT glowing hets, non-glowing steriles (germ cells in oogenesis arrested in pachytene), very rare homozygous hT2 glowing animals, and dead eggs. Vulval development in ksr-2 animals appears normal. The molecular lesion of dx27 is a 285 base deletion. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
UP994 C. elegans sur-6(sv30) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
sur-6(sv30) homozygotes are viable but segregate 100% dead embryos, and are GFP-. Weak Vulvaless and Unc. Maintain strain by picking GFP+ heterozygotes. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
UR109 C. elegans cwp-4(tm727) him-5(e1490) V. Show Description
Him strain. Superficially wild-type. References: Portman and Emmons Dev Bio (2004) & Miller and Portman Mod & Mech (2010).
UR110 C. elegans cwp-2&cwp-3(ok1366) him-5(e1490) V. Show Description
Him strain. Superficially wild-type. References: Portman and Emmons Dev Bio (2004) & Miller and Prtman Mod & Mech (2010).
UR116 C. elegans him-5(e1490) V; cwp-5(tm1893) X. Show Description
Him strain. Superficially wild-type. Males have mating (response) defect but are fertile; otherwise superficially wild-type. Reference: Miller and Prtman Mod & Mech (2010).
UT1 C. elegans lrn-1(mm93). Show Description
Associative learning deficient in several assays: Ion/E. coli appetitive conditioning, Ion/garlic aversive conditioning, Ion/Copper aversive conditioning, Diacetyl/acetic acid aversive conditioning. Sensorimotor normal. Non-associative learning with ions and diacetyl normal. No linkage group info available yet.
UT1306 C. elegans akt-1(mm200) V. Show Description
Benzaldehyde/starvation learning defective. mm200 is a single base pair change resulting in an L199F substitution. Reference: Merritt DM, et al. A Novel Memory Type in C. elegans Exhibits Post-Training Consolidation. bioRxiv 2023.02.22.529281. doi: https://doi.org/10.1101/2023.02.22.529281.
UT1343 C. elegans crh-2(gk3293) II; crh-1(tz2) III. Show Description
Double mutant with loss of function in both CREB genes. Derived by crossing parental strains YT17 crh-1(tz2) and VC3149 crh-2(gk3293). Reference: Merritt DM, et al. A Novel Memory Type in C. elegans Exhibits Post-Training Consolidation. bioRxiv 2023.02.22.529281. doi: https://doi.org/10.1101/2023.02.22.529281.
UT2 C. elegans lrn-2(mm99). Show Description
Associative learning deficient in several assays: Ion/E. coli appetitive conditioning, Ion/garlic aversive conditioning, Ion/Copper aversive conditioning, Diacetyl/acetic acid aversive conditioning. Sensorimotor normal. Non-associative learning with ions and diacetyl normal. No linkage group info available yet.
UTR45 C. elegans par-4(nar13[mNG::3X FLAG::par-4a + loxP]) V. Show Description
Superficially wild-type. nar13 was derived by excision of UTR43(nar12) cassette by heat shock. Tagged endogenous PAR-4A & C: weak, ubiquitous fluorescence. Reference: Roy et al. microPublication Biology. https://www.micropublication.org/roy_2018_mngpar-4.html
UZ101 C. elegans pha-1(e2123) III; xtEx84. Show Description
xtEx84 [ftn-1p(DR1m)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.
UZ105 C. elegans pha-1(e2123) III; xtEx88. Show Description
xtEx88 [ftn-1p(DR2m)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.
UZ111 C. elegans pha-1(e2123) III; xtEx94. Show Description
xtEx94 [ftn-1p(DR3m)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.
UZ275 C. elegans pha-1(e2123) III; xtEx257. Show Description
xtEx257 [ftn-1p(DR123m)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.
UZ495 C. elegans pha-1(e2123) III; xtEx448. Show Description
xtEx448 [ftn-1p(DR123ACm)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.
UZ73 C. elegans pha-1(e2123) III; xtEx61. Show Description
xtEx61 [ftn-1p(G1m)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.
UZ78 C. elegans pha-1(e2123) III; xtEx66. Show Description
xtEx66 [ftn-1p(G2m)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.
UZ88 C. elegans pha-1(e2123) III; xtEx72. Show Description
xtEx72 [ftn-1p(G12m)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.
UZ96 C. elegans pha-1(e2123) III; xtEx79. Show Description
xtEx79 [pes-10(+63)::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.
VBS662 C. elegans nrde-2(gg95) vbaIs52 II; eri-1(mg366) IV. Show Description
vbaIs52 [eef-1A.1p::YFP::nrde-3] II. Maintain at 20C or cooler; germline mortal (Mrt) at 25C. YFP::NRDE-3 localizes to the cytoplasm, except in the germline, early embryo, and intestine. Upon introduction of dsRNA, YFP::NRDE-3 labels transcription sites of dsRNA gene targets. Superficially wild-type. Reference: Toudji-Zouaz A, et al. Nucleic Acids Research. 2021 Jun 9;gkab469. doi: 10.1093/nar/gkab469. PMID: 34107044.
VBS663 C. elegans nrde-2(gg95) vbaIs53 II; eri-1(mg366) IV. Show Description
vbaIs53 [rps-27p::mNeonGreen::Flag::nrde-3] II. Maintain at 20C or cooler; germline mortal (Mrt) at 25C. mNG::NRDE-3 localizes to the cytoplasm. Upon introduction of dsRNA, mNG::NRDE-3 labels transcription sites of dsRNA gene targets. Superficially wild-type. Reference: Toudji-Zouaz A, et al. Nucleic Acids Research. 2021 Jun 9;gkab469. doi: 10.1093/nar/gkab469. PMID: 34107044.