| ZT49 |
C. elegans |
ego-1(fj114[PA::ego-1]) I. Show Description
Four amino-acid residues (G24–V27) near the N-terminus of EGO-1 were replaced with a PA-tag sequence (GVAMPGAEDDVV derived from human podoplanin) in the endogenous ego-1 gene. The PA-tag insertion can be checked by PCR with the following primers: TTCAAAATGCCGCTGCCTTC and GTCCTCTTCGCATCTTTATCAG, followed by digestion with Sau96I. The wild-type ego-1 gene contains a Sau96I site within its PCR region, while the PA-tagged ego-1 does not. This strain was used for immunofluorescence analysis of EGO-1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002. |
|