More Fields
Strain Species Genotype
EL329 C. elegans ego-1(om58)/hT2 [dpy-18(h662)] I; +/hT2 [bli-4(e937)] III. Show Description
Heterozgyotes are WT and segregate WT, Steriles and Dpys. The Steriles produce small, abnormal oocytes; some dead embryos are produced in late adulthood. bli-4 is suppressed by dpy-1 in hT2 homozygotes-only see a very few DpyBli. om58 previously called ego-6(om58).
EL302 C. elegans ego-1(om71) unc-29(e193)/hT2 [dpy-18(h662)] I; +/hT2 [bli-4(e937)] III. Show Description
Heterozygotes are WT and segregate WT, Sterile Uncs and Dpys. bli-4 is suppressed by dpy-18 in hT2 homozygotes-only see a very few DpyBli.
EL391 C. elegans ego-1(om84) unc-29(e193)/hT2 [dpy-18(h662)] I; +/hT2 [bli-4(e937)] III. Show Description
Heterozygotes are WT and segregate WT, mild Unc that are Sterile, and Dpys. bli-4 is suppressed by dpy-18 in hT2 homozygotes-only see a very few DpyBli.
WM215 C. elegans avr-14(ad1302) ego-1(om97) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); avr-15(ad1051) glc-1(pk54)) V. Show Description
Heterozygotes are wild-type, GFP+ and sensitive to ivermectin. Segregates non-GFP ego-1 homozygotes (sterile, resisitant to ivermectin), arrested hT2 aneuploids, and wild-type GFP+ heterozygotes. Maintain by picking GFP+. Do not distribute this strain; other labs should request it directly from the CGC. Reference: Claycomb JM, et al. Cell. 2009 Oct 2;139(1):123-34.
ZT36 C. elegans ego-1(om58) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+ and segregate WT GFP+ heterozygotes, non-GFP ego-1 homozygotes (sterile with inaccurate homologous pairing of meiotic chromosomes), very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT49 C. elegans ego-1(fj114[PA::ego-1]) I. Show Description
Four amino-acid residues (G24–V27) near the N-terminus of EGO-1 were replaced with a PA-tag sequence (GVAMPGAEDDVV derived from human podoplanin) in the endogenous ego-1 gene. The PA-tag insertion can be checked by PCR with the following primers: TTCAAAATGCCGCTGCCTTC and GTCCTCTTCGCATCTTTATCAG, followed by digestion with Sau96I. The wild-type ego-1 gene contains a Sau96I site within its PCR region, while the PA-tagged ego-1 does not. This strain was used for immunofluorescence analysis of EGO-1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.