Search Strains

CRISPR/Cas9 engineered deletion of full casy-1 locus.

CRISPR/Cas9 engineered deletion of full cdh-8 locus.

CRISPR/Cas9 engineered deletion of full fmi-1 locus.

CRISPR/Cas9 engineered deletion of full cdh-12 locus.

otIs796 [flp-12(promDEL3)::GFP + unc-122p::RFP] X. SMB is marked only with GFP, not red. Can be used to isolate SMB by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). This strain carries unc-122p::RFP as a co-injection marker labeling coelomocytes, which can bleed through the green channel; it is not known which red variant was used in the co-injection marker. Make sure the sorted green cells are also not red. Derived by integration of array originally generated in Kyuhyung Kim's lab.

otDf2 is a 25,484 bp deletion of the insulin cluster from Chr I, removing ins-28, ZC334.13, ins-29, ins-25, ins-27, linc-124, ZC334.12, ZC334.17, ins-24, ins-30, and ins-26. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.

otIs837 [unc-25(prom3)(del1)::GFP]. RME neurons are labeled with GFP. Can be used to isolate RME by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

dzIs89 [inx-1p::BirA::nrx-1 + gcy-13p::AP::nlg-1 + gcy-13p::tagBFP + unc-122p::stretavadin::tagRFP] X. cdh-5(ot1093) is a CRISPR/Cas9 engineered deletion of full cdh-5 locus. Reference: Majeed M, et al. Sci Adv. 2025 Feb 21;11(8):eads2852. doi: 10.1126/sciadv.ads2852. PMID: 39983000.

Null allele of unc-86 generated by gRNAs targeted to the first and last exons, resulting in a 3202 bp deletion from -8 to +3194 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341

Null allele of ceh-14 generated by gRNAs targeted to the first and last exons, resulting in a 4056 bp deletion from +40 to +4096 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341

Null allele of unc-30 generated by gRNAs targeted to the first and last exons, resulting in a 5168 bp deletion from -37 to +5131 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341

CRISPR/Cas9 engineered deletion of full cdh-4 locus.

CRISPR/Cas9 engineered deletion of full cdh-9 locus.

ot1264 is a CRISPR deletion removing -10.8 kb to -1.8 kb before the first exon of ttx-1, made in the context of the ttx-1::GFP allele syb1679. Notably ttx-1 expression in RIB is lost, and RIB markers are off or dim. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095

ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1294 is a deletion removing intron 7 from the endogenously-tagged ceh-44 locus, which also removes the UNC-75 binding site. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.

Full gene deletion of the lim-6 locus (-51 to +5144) by CRISPR. Please contact Oliver Hobert prior to publishing work using this strain.

ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1402 is a deletion removing the UNC-75 binding site within intron 7 of the endogenously-tagged ceh-44 locus. Reduced pan-neuronal nuclear CEH-44::GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.

ot1326 is CRISPR-engineered 2,029 bp deletion removing the entire ins-18 coding region. Sequence after edit: AGCTCATTTTAATTTAACACAATGGTCCACCGACTACGTGGAAGATCTTCTTGCCTACTGTGCCCCAATT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.

GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1294 is a deletion removing intron 7 from the endogenously-tagged ceh-44 locus, which also removes the UNC-75 binding site. Normally broad, punctate expression of GFP::CEH-44 is not present. Please contact Oliver Hobert prior to publishing work using this strain.

ot1351 is a CRISPR-engineered deletion of unc-75 gene rendering all 3 RNA recognition motifs null on unc-75; reduces pan-neuronal nuclear GFP expression fluorescence. GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. Please contact Oliver Hobert prior to publishing work using this strain.

ot1357 is CRISPR-engineered 5,741 bp deletion removing the entire aex-1 coding region, eliminating all spice isoforms. Sequence after edit: ACTTTTAACATTTTTAAAGCATTAGTTTTCCTTATGAATAGTCTATATTTTATCGACTGGCCGACATAAt. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.

ot1360 is CRISPR-engineered 1,339 bp deletion removing the entire ins-1 coding region. Sequence after edit: TTATAGGGCATTTTTCAGTTCCTCACCGCTCTCAAATCAGGTCAATATCGTTGGCAGCTCACCGGACCCT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.

CRISPR/Cas9-engineered deletion removing entire hlh-13 locus. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329

CRISPR/Cas9-engineered deletion removing entire hlh-15 locus. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329

syb5437 is a GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. ot1409 is a deletion removing exons 1-7 from the endogenously-tagged cone-1 locus. Broad punctate expression of GFP. Please contact Oliver Hobert prior to publishing work using this strain.

syb5437 is a GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. ot1410 is a deletion removing exon 5 from the endogenously-tagged cone-1 locus. Broad punctate expression of GFP. Please contact Oliver Hobert prior to publishing work using this strain.

ot1427 is CRISPR-engineered 1,007 bp deletion removing the entire ins-7 coding region. Sequence after edit: CTTCGAAGGATAACCCCGAAGAAGCTGTTCCAAAACATAATGGTGGCTCTTCTGGATTTTGGGTTCAATT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.

CRISPR/Cas9-engineered 1691 bp deletion removing entire hlh-32 locus; similar to syb6773 deletion. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329

ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1433 is a deletion removing exons 4-7 from the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.

ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1434 is a deletion removing exons 1-7 from the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.

ot1443 is CRISPR-engineered 646 bp deletion of the ins-35 gene removing all the coding sequence except the last 7 aa, which should not be translated due to the absence of an ATG. Sequence after edit: ttctgaaatttttgaaattgtctaattttcCAGCAGACTCAGATGAACTATTCAATTAATAATTTAAGTT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.

ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1447 is a deletion removing exon 5 of the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.

Null allele. ot1466 is a CRISPR-engineered deletion removing the complete CDS. Normal growth & viability. Reference: Bayer E, et al. 2025. biorxiv: https://www.biorxiv.org/content/10.1101/2025.01.01.631014v2

CRISPR/Cas9 full deletion removing the entire coding-region of unc-42. Him and Unc. Reference: Fernandez RW, et al. Development. 2025 Aug 15;152(16):dev204958. doi: 10.1242/dev.204958. PMID: 40838983.

ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1434 is a deletion removing exons 5-7 from the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.

ot1545 is CRISPR-engineered 2,838 bp deletion removing the entire tph-1 coding region. Sequence after edit: tgtatattacgtgccgaattccagaagcaccacgcccaacacaaagacacgttttcctgcagaagaggaa. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.

otIs39 [unc-47(delta)::GFP + lin-15(+)].

Worms appear WT. 1071 bp deletion removes the entire lsy-6 hairpin and part of the predicted C32C4.3 gene. ASEL takes on ASER gene expression profile.

otIs114 [lim-6p::GFP + rol-6(su1006)]. ot123 is a semi-dominant deletion allele of part of the cog-1 3' UTR, a lsy-6 miRNA target. Loss of miRNA regulation leads to ectopic expression of cog-1 in ASEL, which transforms ASEL to have ASER fate. otIs114, normally expressed in only ASEL and excretory gland cells, is lost in ASEL in ot123. Animals tend not to Roll.

oyIs14 [sra-6::GFP + lin-15(+)]. otEx3140 [unc-14p::sax-7cDNA long-delta11 + rol-6(su1006)]. Pick Rollers to maintain. Reference: Pocock R, et al., Mol Cell Neurosci. 2008 Jan;37(1):56-68.

oyIs14 [sra-6::GFP + lin-15(+)]. otEx3141 [unc-14p::sax-7cDNA long-delta11 + rol-6(su1006)]. Pick Rollers to maintain. Reference: Pocock R, et al., Mol Cell Neurosci. 2008 Jan;37(1):56-68.

otIs39 [unc-47(delta)::GFP + lin-15(+)]. Expressed in RMEL/R, AVL, RIS, DVB, PVT and unidentified amphid sensory neuron pair.

Pick wild-type to maintain. Heterozygotes are wild-type and should segregate wild-type heterozygotes, bcl-11 homozygotes (L1 larval arrest with starved appearance), and Dpy Unc homozygotes (Medium Dpy, Shrinker, poor backing). Maintain by picking wild-type and scoring for proper segregation of progeny. bcl-11 homozygotes have weak pharyngeal muscle contractions and pharyngeal lumen fails to open. cu10 is a 555 bp deletion (V:6360921..6361460). Predicted bcl-11 null allele. Reference: Vilimas, Tomas. (2004). Genes regulating ceh-22 and pharyngeal development of Caenorhabditis elegans.. University of Illinois at Chicago. Thesis. https://hdl.handle.net/10027/12060

A 600 bp deletion in the unc-60b coding region. unc-60a is intact. Strong Unc - nearly paralyzed. No UNC-60b protein is detected by western blot. UNC-60a is expressed at normal level.

Bacteria. RNAi-compatible OP50 strain. Slow growing. When growing this strain, pick single colonies for liquid culture (at least 20 hrs) from a freshly streaked tetracycline LB plate. Do not include tetracycline in liquid culture, as Tet in liquid culture can have long lasting effects on worm lifespan. The authors recommend using standard PEG transformation method to make competent OP50(xu363) cells, but other ways to make competent cells will also likely work for OP50(xu363). Reference: Xiao R, et al. Cell Rep. 2015 May 19;11(7):1123-33.

CRISPR/Cas9 engineered 1515 bp deletion of gmap-1; flanking sequences ACCTATCCAAAGCTT and TGCCAAGACATTGAA. Dessication sensitive. Shorter body length. Increased permeability of the cuticle. Reference: Ngale Njume F, et al. iScience. 2022 Oct 14;25(11):105357. doi: 10.1016/j.isci.2022.105357. PMID: 36339267.

ulbEx112 [gmap-1p::gmap-1(cDNA)::SL2::GFP + unc-122p::RFP]. Pick animals with RFP+ expression in coelomocytes to maintain. ulb13 is a CRISPR/Cas9 engineered 1515 bp deletion of gmap-1; flanking sequences ACCTATCCAAAGCTT and TGCCAAGACATTGAA. Expression of exogenous gmap-1 quantifiable via the GFP signal. Reference: Ngale Njume F, et al. iScience. 2022 Oct 14;25(11):105357. doi: 10.1016/j.isci.2022.105357. PMID: 36339267.

Crispr/Cas9 engineered deletion mutant removes 28 basepairs in tdo-2 coding region. Reference: Michels H, et al. Sci Rep. 2016 Dec 20;6:39199.

Crispr/Cas9 engineered deletion mutant removes 14 basepairs in tdo-2 coding region. Reference: Michels H, et al. Sci Rep. 2016 Dec 20;6:39199.

Crispr/Cas9 engineered deletion mutant removes 9 basepairs in tdo-2 coding region. Reference: Michels H, et al. Sci Rep. 2016 Dec 20;6:39199.