Strain Information
| Name | OH18508 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | daf-16(ot971[daf-16::GFP]) I; ins-1(ot1360) IV. |
| Description | ot1360 is CRISPR-engineered 1,339 bp deletion removing the entire ins-1 coding region. Sequence after edit:TTATAGGGCATTTTTCAGTTCCTCACCGCTCTCAAATCAGGTCAATATCGTTGGCAGCTC ACCGGACCCT. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https://doi.org/10.1101/2025.01.06.631508. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Surojit Sural |
| Laboratory | OH |
| Reference | Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https://doi.org/10.1101/2025.01.06.631508. |
Sign in
or
register an account if you want to order this strain.