Strain Information

Name OH18508   View On Wormbase
Species C. elegans
Genotypedaf-16(ot971[daf-16::GFP]) I; ins-1(ot1360) IV.
Descriptionot1360 is CRISPR-engineered 1,339 bp deletion removing the entire ins-1 coding region. Sequence after edit:TTATAGGGCATTTTTCAGTTCCTCACCGCTCTCAAATCAGGTCAATATCGTTGGCAGCTC
ACCGGACCCT.
Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
MutagenCrispr/Cas9
Outcrossedx0
Made bySurojit Sural
Laboratory OH
Reference Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
Sign in or register an account if you want to order this strain.