Search Strains

An approx. 1-8 kb deletion in the ZK1248.3 gene which encodes a C. elegans homolog of the Eps15 (vertebrate) and pan1 (S. cervesisiae) gene. No obvious behavioral or morphological phenotypes.

Viable, fertile, with no obvious behavioral or morphological phenotypes. A 1677 bp deletion in the C18H9.7 gene which encodes a C. elegans homolog of the rapysn (vertebrate) gene. The lesion deletes exons 4 through 10, leaving exons 3 and 11 in frame. The deletion junction is cagaagaaaaagttcgctttgaactaaAGAACCTATTGAAAATTCTTACTT. Previously called rap-1.

Uncoordinated and aldicarb resistant. Molecular lesion: deletion of entire unc-10 coding region. Gene encodes C. elegans homolog of Rab3 interacting molecule. Will mate, but poorly.

snt-1 encodes the C. elegans homolog of synaptotagmin I. md290 is a deletion that removes most of the coding sequence. Strain is a slow growing aldicarb resistant (Ric) Unc. Males won't mate.

rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4431. Reference: Dour S and Nonet ML. In preparation.

jsIs682 [rab-3p::GFP::rab-3 + lin-15(+)] III. rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals with GFP::RAB-3 mislocalized to neuronal cell bodies. Presence of jsIs682 makes definitive identification of ok3296 homozygotes much easier. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4337. Reference: Dour S and Nonet ML. In preparation.

jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1518 [LoxP::UAS 11X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1515 [LoxP::mec-4p::GAL4-QF::FRT3] IV. RMCE derived single copy UAS GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p GAL-4-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.

jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1527 [LoxP::lexO 5X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1549 [LoxP::mec-4p::lexA-L-QF::FRT-3] IV. RMCE derived single copy lexO GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p lexA-L-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.

jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1517 [LoxP::QUAS 5X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1551 [LoxP::mec-4p::QF::FRT3] IV. RMCE derived single copy QUAS GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.

jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1543 [LoxP::tetO 7X::(delta)mec-7p::(delta)mec-7p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1548 [LoxP::mec-4p::rtetR-L-QF::FRT3] IV. RMCE derived single copy tetO GFP-C1 reporter line on Chr I and RMCE derived single copy tet ON mec-4p rtetR-L-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.

jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1517 [LoxP::QUAS 5X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1554 [LoxP::mec-4p::QF2::FRT3] IV. RMCE derived single copy QUAS GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p QF2 driver on Chr IV. Reference: Nonet ML. Genetics. 2020.

jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1519 [LoxP::tetO 7X:: (delta)pes10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSI1560 [LoxP::mec-4p::tetR-L-QF::FRT3] IV.RMCE derived single copy tetO GFP-C1 reporter line on Chr I and RMCE derived single copy tet OFF mec-4p tetR-L-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.

jsSi1570 [delta_mosL::loxP::rpl-28::FRT::GFP::his-58::FRT3::mosR] I. bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Dual component RMCE landing site on Chromosome I. Derivative of jsTi1453 lacking the left mos1 arm.

ltSi539 [dlg-1p(delta)7::mCherry::his-72::unc-54 3’UTR + cnd-1p::mCherry::his-72::unc-54 3’UTR + Cbr-unc-119(+)] II. ltSi507 [hlh-1p::GFP::his-72::tbb-2 3’UTR + hlh-1p::mCherry::his-72::tbb-2 3’UTR +Cbr-unc-119(+)] IV. stIs10389 [pha-4::TGF(3E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. During embryogenesis, ectoderm fluoresces red, mesoderm fluoresces yellow, and endoderm/pharynx fluoresces green. Reference: Wang S, et al. Development. 2019 Apr 11;146(7):dev174029. doi: 10.1242/dev.174029. PMID: 30890570.

CRISPR/Cas9 engineered deletion of mdf-2 in which the mdf-2 coding sequence was replaced by unc-119. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (low brood size/embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Unknown if unc-119(ed3) from parental strain is still carried in the background. gRNA sequence: Gccaaattccccagttttag Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.

CRISPR/Cas9 engineered deletion of fzy-1 in which the fzy-1 coding sequence was replaced by LoxP. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate wild-type dim GFP (heterozygotes), Dpy bright GFP (mIn1 homozygotes), and non-GFP fzy-1 homozygotes (larval arrest). Pick wild-type with dim GFP and check for correct segregation of progeny to maintain. gRNA sequence: Ggacgcacgcccggtagtgc Reference: Kim T, et al. Genes Dev. 2017 Jun 1;31(11):1089-1094. doi: 10.1101/gad.302067.117. PMID: 28698300.

ltSi249 [dlg-1p(delta)7::dlg-1::GFP::unc-54 3'UTR Cbr-unc-119(+)] I. ltSi511 [cnd-1p::mCherry::PH::unc-54 3'UTR Cbr-unc-119(+)] II. During embryogenesis epidermal cell junctions fluoresce green and neuronal cell surface fluoresces red. Reference: Wang S, et al. Development. 2019 Apr 11;146(7):dev174029. doi: 10.1242/dev.174029. PMID: 30890570.

CRISPR/Cas9 engineered deletion of cyb-3. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. gRNA sequences: tcaggtcgacattcttggcc & gttatgggtatgagagcatt Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.

ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)].

ltIs42[pAA19; pie-1::GFP-TEV-Stag::CAR-1deltaN; unc-119(+)].

ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)].

ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)]. ltIs24 [pAZ132; pie-1::GFP::tba-2 + unc-119(+)].

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)]. Superficially wild-type. Maintain under normal conditions. Reference: Essex A, et al. Mol Biol Cell. 2009 Feb;20(4):1252-67. doi: 10.1091/mbc.e08-10-1047. Epub 2008 Dec 24. PMID: 19109417

Dyf. Osm. Throws males. Reduced mating efficiency (ME 2-3). Deletion extends over 1610 bp in the intron between exons 3 and 4 and ending 30 bp after the STOP codon (cosmid F02D8 pb 25954-27563 are deleted). Complements dyf-4(m158).

Shortened locomotor healthspan. ix261 missense allele causes phenotype similar to that of deletion alleles. Reference: Kawamura K, & Maruyama IN. Aging (Albany NY). 2020 Dec 3;12(23):23525-23547.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. TPR domain deleted in the endogenous ogt-1 locus using CRISPR/Cas9; Sanger sequence confirmed. The TPR domain deletion (128 aa - 583 aa) ablates the O-GlcNAcylation activity of OGT-1 as measured by the RL2 O-GlcNAc antibody. Defective gpdh-1p::GFP induction in the hypodermis and intestine during hypertonic stress. Constitutive col-12p::DsRed expression. Impaired adaptation to hypertonic stress. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

TPR domain deleted in the endogenous ogt-1 locus tagged with C-terminal GFP. The TPR domain deletion spans 128 aa - 583 aa. OGT-1(delta-TPR)::GFP is expressed ubiquitously in somatic tissues with a nuclear localization. The TPR domain deletion ablates the O-GlcNAcylation activity of OGT-1 as measured by the RL2 O-GlcNAc antibody. Sanger sequence confirmed. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

Segregates WT GFP+ heterozygotes, larval-arrested ok600 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. [NOTE: Although ok600 has been reported as a 1085 bp deletion in hsf-1, sequencing of the hsf-1 PCR product revealed only an 877 bp deletion (5'-AAATAAAAATTTCTTAGAAA [877 bp deletion] TGTACATGGGATCCGGTCCA-3'). (Lamitina Lab, 12/17/2012)]

Egl. Exp. Syn daf-c. 1.7 kb deletion in lim-6 locus.

otEx5021 [lsy-6(fosmid - delta 300 bp 3')::GFP + ttx-3::mCherry]. Maintain by picking animals with mCherry expression in the AIY neurons.

otEx5022 [lsy-6(fosmid - delta 150 bp 3') + ttx-3::mCherry]. otIs3 [gcy-7p::GFP + lin-15(+)] V. Maintain by picking animals with mCherry expression in the AIY neurons. Fosmid with 150 bp deletion does not rescue ASE asymmetry.

otEx5027 [lsy-6(fosmid - delta 3 kb 3')::YFP + ttx-3::mCherry]. Maintain by picking animals with mCherry expression in the AIY neurons.

otIs386 [lsy-6(fosmid - delta 150 bp 3')::GFP + ttx-3::mCherry].

otEx4963 [lsy-6p(fosmid delta 150bp downstream)::GFP + ttx-3:mCherry]. Maintain otEx4963 by picking animals with mCherry in the AIY neurons. otIs306 [hsp-16.2::che-1::3xHA + rol-6(su1006)]. Rollers.

otIs39 [unc-47(delta)::GFP + lin-15(+)]. Expressed in RMEL/R, AVL, RIS, DVB, PVT and unidentified amphid sensory neuron pair.

oyIs14 [sra-6::GFP + lin-15(+)] V. ot820 is an 8bp deletion 15bp from the start of the sax-7S start codon, resulting in a frameshift and sax-7S isoform-specific null allele.

Phenotypically WT. In hst-6(ok273) , 1064 nt are deleted following position 39378 in Y34B4A (ACC# AC024755) and replaced by four nucleotides CTTT.

No obvious phenotype; partial effects on AiY interneuron differentiation; genotyped by PCR that covers the deletion in the ceh-23(ms23) allele.

Null allele generated by gRNAs targeted to the first and last exons of ceh-14, resulting in a 4061bp deletion from +35 to +4098 relative to the start of the ORF.

C09C7.1 Deletion breakpoints at position 237 and 803 with insertion of CTTGTATAGCAAGAAACC at this breakpoint. Predicted molecular null. About 30% penetrance of displaced axons in the ventral nerve cord. Homozygous viable.

CRISPR-engineered deletion in dmd-4(ot935[dmd-4::GFP]) removing +3201 to +3710 relative to start codon. Partial removal of intron 3 results in loss of somatic nervous system expression without affecting pharyngeal expression.

otDf1is a deletion obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method removing ceh-41, ceh-21, T26C11.9, and ceh-39. 8968 bp deletion, from position -159 upstream ceh-39 ATG, to +1608 from ATG ceh-41 (+89 from STOP ceh-41).

ot1028 = 80bp deletion on Exon 8 (first exon isoform A - isoform with CUT domains), leading to a frameshift and early stop codon in Exon 8 expected to affect only isoform A. Deletion coordinates: +9069 to +9148. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method. ot1028 is molecularly identical to ot1031.

otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. CUT Sextuple mutant animals show reduced pan-neuronal gene expression, impaired locomotion and resistance to aldicarb induced paralysis. otDf1 is a deletion affecting ceh-41, ceh-21, T26C11.9, and ceh-39. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341.

CRISPR/Cas9 engineered deletion of full cdh-1 locus.

CRISPR/Cas9 engineered deletion of full cdh-3 locus.

Presumed null allele nlp-45. ot1046 deletion causes a frameshift resulting in a shortened coding sequence that doesn't include mature neuropeptide. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.

Presumed null allele nlp-45. ot1047 deletion causes a frameshift resulting in a shortened coding sequence that doesn't include mature neuropeptide. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.

ot1066 is an engineered deletion of the full ceh-53 locus. Reference: Vidal B, et al. Elife. 2022 Mar 24;11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425

ot1067 is an engineered deletion of the full ceh-79 locus. Reference: Vidal B, et al. Elife. 2022 Mar 24;11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425