Strain Information

Name OH18835   View On Wormbase
Species C. elegans
Genotypeins-7(ot1427) IV.
Descriptionot1427 is CRISPR-engineered 1,007 bp deletion removing the entire ins-7 coding region. Sequence after edit:CTTCGAAGGATAACCCCGAAGAAGCTGTTCCAAAACATAATGGTGGCTCTTCTGGATTTT
GGGTTCAATT.
Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
MutagenCrispr/Cas9
Outcrossedx0
Made bySurojit Sural
Laboratory OH
Reference Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
Sign in or register an account if you want to order this strain.