Strain Information

Name OH19337   View On Wormbase
Species C. elegans
Genotypetph-1(ot1545) II.
Descriptionot1545 is CRISPR-engineered 2,838 bp deletion removing the entire tph-1 coding region. Sequence after edit:tgtatattacgtgccgaattccagaagcaccacgcccaacacaaagacacgttttcctgc
agaagaggaa.
Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
MutagenCrispr/Cas9
Outcrossedx0
Made bySurojit Sural
Laboratory OH
Reference Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
Sign in or register an account if you want to order this strain.