Strain Information
| Name | OH19337 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | tph-1(ot1545) II. |
| Description | ot1545 is CRISPR-engineered 2,838 bp deletion removing the entire tph-1 coding region. Sequence after edit:tgtatattacgtgccgaattccagaagcaccacgcccaacacaaagacacgttttcctgc agaagaggaa. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Surojit Sural |
| Laboratory | OH |
| Reference | Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
Sign in
or
register an account if you want to order this strain.