Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC1218 C. elegans ins-18(ok1672) I. Show Description
T28B8.2. Superficially wild type. External left primer: TTCAGATTGCTCGAAAGGCT. External right primer: GCCATTGTATCCATCCCATC. Internal left primer: CGTCGCCACTATTCCAAAAT. Internal right primer: CGTATTTTGTGGGCGGTACT. Internal WT amplicon: 2143 bp. Deletion size: 940 bp. Deletion left flank: AAGCTGGTTTGTTTTCATGTTTGTAATACA. Deletion right flank: TTTGGCAATTGGCAATTATTTAATTCTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
GR2116 C. elegans mgEx579. Show Description
mgEx579 [ins-18p::GFP + rol-6(su1006)]. Pick Rollers to maintain. ins-18::GFP promoter fusion containing 4.9 kb upstream regulatory sequence and 2.1 kb of coding region (including exons and introns) driving GFP expression with 0.8 kb downstream sequence. Reference: Pierce SB, et al. Genes Dev. 2001 Mar 15;15(6):672-86.
GR2117 C. elegans daf-2(e1365) III; mgIs35. Show Description
mgIs35 [ins-1(genomic) + mec-7p::GFP]. Temperature-sensitive. Maintain at 15C. Daf-c. High penetrance of dauer formation at 20C. Integration of mgEx557. Reference: Pierce SB, et al. Genes Dev. 2001 Mar 15;15(6):672-86.
IK581 C. elegans ins-1(nj32) IV. Show Description
Reference: Kodama E, et al. Genes Dev. 2006 Nov 1;20(21):2955-60.
OH10237 C. elegans otIs326 X. Show Description
otIs326 [ins-1::GFP + rol-6(su1006)] X. Rollers.
OH18320 C. elegans ins-18(ot1326) daf-16(ot971[daf-16::GFP]) I. Show Description
ot1326 is CRISPR-engineered 2,029 bp deletion removing the entire ins-18 coding region. Sequence after edit: AGCTCATTTTAATTTAACACAATGGTCCACCGACTACGTGGAAGATCTTCTTGCCTACTGTGCCCCAATT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
OH18508 C. elegans daf-16(ot971[daf-16::GFP]) I; ins-1(ot1360) IV. Show Description
ot1360 is CRISPR-engineered 1,339 bp deletion removing the entire ins-1 coding region. Sequence after edit: TTATAGGGCATTTTTCAGTTCCTCACCGCTCTCAAATCAGGTCAATATCGTTGGCAGCTCACCGGACCCT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
OH18707 C. elegans otIs904 V. Show Description
otIs904 [ges-1p::ins-1::tagRFP-T::SL2::GFP::his-44::tbb-2 3’ UTR + inx-6p18::tagRFP::unc-54 3' UTR] V. Transgene allows monitoring of the secretion of INS-1 neuropeptide from the intestine under different physiological conditions. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
PHX5452 C. elegans ins-1(syb5452[ins-1::SL2::gfp::H2B]) IV. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
PHX5462 C. elegans ins-18(syb5462[ins-18::SL2::GFP::his-44]) I. Show Description
SL2::GFP::HIS-44 tag inserted into the endogenous ins-18 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
FX1053 C. elegans ins-11(tm1053) II. Show Description
Superficially wild type. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
HT1686 C. elegans unc-119(ed3) III; wwEx61. Show Description
wwEx61 [ins-1p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
HT1711 C. elegans unc-119(ed3) III; wwEx69. Show Description
wwEx69 [ins-10p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
HT1714 C. elegans unc-119(ed3) III; wwEx70. Show Description
wwEx70 [ins-11p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
HT1718 C. elegans unc-119(ed3) III; wwIs27. Show Description
wwIs27 [ins-12p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
HT1720 C. elegans unc-119(ed3) III; wwIs28. Show Description
wwIs28 [ins-13p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
HT1722 C. elegans unc-119(ed3) III; wwIs29. Show Description
wwIs29 [ins-14p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
HT1728 C. elegans unc-119(ed3) III; wwEx71. Show Description
wwEx71 [ins-15p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
HT1730 C. elegans unc-119(ed3) III; wwEx72. Show Description
wwEx72 [ins-16p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
HT1734 C. elegans unc-119(ed3) III; wwEx73. Show Description
wwEx73 [ins-17p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
HT1737 C. elegans unc-119(ed3) III; wwEx74. Show Description
wwEx74 [ins-18p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
HT1741 C. elegans unc-119(ed3) III; wwIs30. Show Description
wwIs30 [ins-19p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
IK3240 C. elegans njIs115 IV. Show Description
njIs115 [ins-1p::flp + gcy-28dp::frt::tomm-20(N-55AA)::miniSOG + ges-1p::NLS::GFP] IV.Targeted ablation of AIA neuron. Reference: Ikeda M, et al. Proc Natl Acad Sci USA. 2020 Mar 2;117(11):6178–6188. PMID: 32123108.
IK3263 C. elegans njIs120 V. Show Description
njIs120 [ins-1p::cz::caspase-3(p17) + gcy-28dp::caspase-3(p12)::nz + ges-1p::NLS::GFP] V.Targeted ablation of AIA neuron. Reference: Ikeda M, et al. Proc Natl Acad Sci USA. 2020 Mar 2;117(11):6178–6188. PMID: 32123108.
IK3592 C. elegans njEx1548. Show Description
njEx1548 [ins-1p::FLP + gcy-28dp::FRT::HisCI1::SL2::mCherry + ges-1p::NLS::GFP]. Pick GFP+ to maintain. Cell silencing of AIA neuron. Reference: Ikeda M, et al. Proc Natl Acad Sci USA. 2020 Mar 2;117(11):6178–6188. PMID: 32123108.
JN580 C. elegans peIs580. Show Description
peIs580 [ins-1p(short)::casp1 + ins-1p(short)::Venus + unc-122p::GFP]. AIA neurons are ablated by specific expression of caspase. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210.
PS8636 C. elegans ins-10(sy1437) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ins-10. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAAAAAACAATTCTTCTAATCTCATTCTTGCTCCTCGT right flanking sequence: AACATTGGCTCCCAGAACAAGTGCAGCTTTTCCATTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCTGGGAGCCAATGTTACG Method Reference: G3 (Bethesda).
RB2159 C. elegans ins-16(ok2919) III. Show Description
Y39A3A.5 Homozygous. Outer Left Sequence: gagcgcgtaaatcttagcca. Outer Right Sequence: ttaattccggcaaagtaccg. Inner Left Sequence: gtctgaaccttggtcaagca. Inner Right Sequence: ggaaaatttcaatttcggca. Inner Primer PCR Length: 1191. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2489 C. elegans ins-15(ok3444) II. Show Description
F41G3.17 Homozygous. Outer Left Sequence: catccggctttcaatcattt. Outer Right Sequence: gcacatctcactgctccaaa. Inner Left Sequence: gaacggtatccttttcatcca. Inner Right Sequence: atgttctgcaccctgaaacc. Inner Primer PCR Length: 1364. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807