Reference: Kodama E, et al. Genes Dev. 2006 Nov 1;20(21):2955-60.

mgIs35 [ins-1(genomic) + mec-7p::GFP]. Temperature-sensitive. Maintain at 15C. Daf-c. High penetrance of dauer formation at 20C. Integration of mgEx557. Reference: Pierce SB, et al. Genes Dev. 2001 Mar 15;15(6):672-86.

otIs326 [ins-1::GFP + rol-6(su1006)] X. Rollers.

CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.

Superficially wild type. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

mgEx579 [ins-18p::GFP + rol-6(su1006)]. Pick Rollers to maintain. ins-18::GFP promoter fusion containing 4.9 kb upstream regulatory sequence and 2.1 kb of coding region (including exons and introns) driving GFP expression with 0.8 kb downstream sequence. Reference: Pierce SB, et al. Genes Dev. 2001 Mar 15;15(6):672-86.

wwEx61 [ins-1p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.

wwEx69 [ins-10p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.

wwEx70 [ins-11p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.

wwIs27 [ins-12p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.

wwIs28 [ins-13p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.

wwIs29 [ins-14p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.

wwEx71 [ins-15p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.

wwEx72 [ins-16p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.

wwEx73 [ins-17p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.

wwEx74 [ins-18p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.

wwIs30 [ins-19p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.

peIs580 [ins-1p(short)::casp1 + ins-1p(short)::Venus + unc-122p::GFP]. AIA neurons are ablated by specific expression of caspase. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210.

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ins-10. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAAAAAACAATTCTTCTAATCTCATTCTTGCTCCTCGT right flanking sequence: AACATTGGCTCCCAGAACAAGTGCAGCTTTTCCATTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCTGGGAGCCAATGTTACG Method Reference: G3 (Bethesda).

Y39A3A.5 Homozygous. Outer Left Sequence: gagcgcgtaaatcttagcca. Outer Right Sequence: ttaattccggcaaagtaccg. Inner Left Sequence: gtctgaaccttggtcaagca. Inner Right Sequence: ggaaaatttcaatttcggca. Inner Primer PCR Length: 1191. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F41G3.17 Homozygous. Outer Left Sequence: catccggctttcaatcattt. Outer Right Sequence: gcacatctcactgctccaaa. Inner Left Sequence: gaacggtatccttttcatcca. Inner Right Sequence: atgttctgcaccctgaaacc. Inner Primer PCR Length: 1364. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T28B8.2. Superficially wild type. External left primer: TTCAGATTGCTCGAAAGGCT. External right primer: GCCATTGTATCCATCCCATC. Internal left primer: CGTCGCCACTATTCCAAAAT. Internal right primer: CGTATTTTGTGGGCGGTACT. Internal WT amplicon: 2143 bp. Deletion size: 940 bp. Deletion left flank: AAGCTGGTTTGTTTTCATGTTTGTAATACA. Deletion right flank: TTTGGCAATTGGCAATTATTTAATTCTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807