Search Strains

fxSi9 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi9 is a CRISPR-engineered site in the MY16 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi9 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).

fxSi10 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi10 is a CRISPR-engineered site in the CB4856 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi10 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).

fxSi11 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi11 is a CRISPR-engineered site in the JU775 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi11 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).

fxSi13 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::Lox2272 (III:10158855)]. fxSi13 is a CRISPR-engineered site in the N2 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTCCAGCGGCAGATCGGCGGAGG) with a split hygromycin resistance selection marker; fxSi13 also introduced a small deletion of genomic sequence at the insertion site (III:10158856-10158894).

fxIs47 [rps-0p::5’ (delta)HygR::GCGAAGTGACGGTAGACCGT::3’ (delta)HygR::unc-54 3’::LoxP, II:8420157]. Phenotypically wild-type strain carrying a landing pad for barcode integrations. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.

Animals are small, developmentally delayed, and have reduced expression of certain olfactory receptors. oy38 is a complex rearrangement of kin-29 genomic sequences.

CRISPR/Cas9-engineered deletion of him-5. High incidence of males. Reference: Macaisne N, et al. Genetics (2018) 2010:843-856. PMID 30242011

tm442 is a 411 bp deletion and 13 bp insertion. Outcrossed to mC6g males. Reference: Large and Mathies (2010) Dev Biol 339(1):51-64.

tm1692 is a 656 bp deletion and 13 bp insertion. Outcrossed to mC6g males. Reference: Large and Mathies (2010) Dev Biol 339(1):51-64.

Homozygous lethal deletion chromosome balanced by hT2. GFP+ heterozygotes are wild-type that segregate wild-type GFP+, arrested hT2 aneuploids, and non-GFP tm3309 homozygotes. tm3395 homozygotes are maternal effect lethal (late embryo & larval lethal) and have progeny with gonadogenesis defects. Pick wild-type GFP+ animals to maintain. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.

Heterozygotes are mostly wild-type but occasionally lack a gonad arm; segregate tm4567 homozygotes (larval/embryonic lethal) and rol-9 homozygotes (Rol). Pick non-Rol to maintain and screen for larval lethals (or by PCR) for tm4567 deletion. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.

Homozygous lethal deletion chromosome balanced by hT2. GFP+ heterozygotes are wild-type that segregate wild-type GFP+, arrested hT2 aneuploids, and non-GFP tm3309 homozygotes. tm3309 homozygotes are maternal effect lethal (late embryo & larval lethal) and have gonadogenesis defects. Previously known as swsn-2.1(tm3309). Pick wild-type GFP+ animals to maintain. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.

Homozygous lethal deletion chromosome balanced by hT2. GFP+ heterozygotes are wild-type and segregate wild-type GFP+, arrested hT2 aneuploids, and non-GFP tm4795 homozygotes. tm4795 homozygotes arrest as early larvae. Pick wild-type GFP+ animals to maintain. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.

rrrIs2 contains [pie-1p::GFP::Histone H2B::cye-1 3'UTR (S1mt+deltaS2-3)+ unc-119(+)]. Slightly Unc.

ZK970.6 Homozygous. Outer Left Sequence: CGGTGTCATTTCAGAGAGCA. Outer Right Sequence: GTTGAGGCAACCTTAAGCGA. Inner Left Sequence: TTGCTCAGCTTTTGGCCTAT. Inner Right Sequence: AGTGCGGATTGTCTGGAAAG. Inner Primer WT PCR Product: 3316. Deletion size: 1545 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01F6.1 Homozygous. Outer Left Sequence: GGTTTTAGGAAACGGCATCA. Outer Right Sequence: AGCGTTACGAATTTTGGCAC. Inner Left Sequence: CTAGCAGGAGTGGTCTTGCC. Inner Right Sequence: GGATCAAAATGGAACATCCG. Inner Primer WT PCR Product: 2438. Deletion size: 1583 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T19D2.1. Homozygous. Outer Left Sequence: GAGGAAATCGCGATGAAGAG. Outer Right Sequence: TCTCCGCAGTTTACAGAGCA. Inner Left Sequence: AGAGTTGGCTGTATTTGCGG. Inner Right Sequence: CGGCACATTCTGAAAGTCAA. Inner Primer WT PCR Product: 3298. Deletion size: 1666 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK455.1. Previously called gei-22. Homozygous. Outer Left Sequence: CACACACAAAAACGGACAGG. Outer Right Sequence: TCGTTGCTCCAAATCACAAA. Inner Left Sequence: AGACGAGCTTCCAATCTCCA. Inner Right Sequence: TTCCTCCGTTGCGGTAATAG. Inner Primer WT PCR product: 2984. Deletion size: 540 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08E3.4. Homozygous. Outer Left Sequence: GGATGGACTCGAACCAAAAA. Outer Right Sequence: TTCTGGAGGGTCTCTGCCTA. Inner Left Sequence: TTGCAGGAAACACAACGAAG. Inner Right Sequence: CAAATTTGCCATATGTTGCG. Inner Primer WT PCR product: 2983. Deletion size: 1146 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R02D3.1. Homozygous. Outer Left Sequence: TGTTCAAGCGTAACACGACC. Outer Right Sequence: AAACCATTTGGATTGCCGTA. Inner Left Sequence: CAGATGTCTGCCGCTGTAAC. Inner Right Sequence: TTCAACACAACCAAATCCGA. Inner Primer WT PCR product: 3055. Deletion size: 923 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C08B6.4. Homozygous. Outer Left Sequence: AACACAACGAGGGACCTGAC. Outer Right Sequence: TGAACGCATCTGGATCATGT. Inner Left Sequence: GAGTCGGGGAAAAAGGGATA. Inner Right Sequence: GGTCGACCTAATGGAGACCA. Inner Primer WT PCR product: 2177. Deletion size: 1624 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C16C10.12. Homozygous. Outer Left Sequence: GAGAAAGTGAGCTCCGCAAT. Outer Right Sequence: GCCTACAAAAATGCCATTCG. Inner Left Sequence: ATCACATCGAGGCAAGCTCT. Inner Right Sequence: CAATCGATACAAGCAGCCAA. Inner Primer WT PCR Product: 2693. Deletion size: 635 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K07C11.5. Homozygous. Outer Left Sequence: GAACGGCCTATGGTGACACT. Outer Right Sequence: TGAGCAGAACGAAAGGAGGT. Inner Left Sequence: GACAATTGTTTTTGGACGGG. Inner Right Sequence: CCGAGCAAATTTGGAAACAT. Inner Primer WT PCR product: 2642. Deletion size: 1680 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48C3A.14 [Merged Y48C3A.15 in to this gene based on BLASTX homologies.] Homozygous. Outer Left Sequence: GACACCCTTGGTGTTCAGGT. Outer Right Sequence: ATCACTTTTCCTCGGGGAGT. Inner Left Sequence: TTGTGGCGACTCTGATGAAG. Inner Right Sequence: ACGAACATTTGAATTTCCCG. Inner Primer WT PCR Product: 2998. Deletion size: 2275 bp; includes insertion of approximately 1150 bp at break. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK970.6. Homozygous. Outer Left Sequence: CGGTGTCATTTCAGAGAGCA. Outer Right Sequence: GTTGAGGCAACCTTAAGCGA. Inner Left Sequence: TTGCTCAGCTTTTGGCCTAT. Inner Right Sequence: AGTGCGGATTGTCTGGAAAG. Inner Primer WT PCR Product: 3316. Deletion size: 2542 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11C7.4 Homozygous. Outer Left Sequence: TGAATCTTTGCAATTCGTGG. Outer Right Sequence: CTTGGTGTTCAACATGACCG. Inner Left Sequence: ATTGGCAAACGATTTTCTCG. Inner Right Sequence: CAGTCAACGGACAGCTTGAA. Inner Primer WT PCR Product: 3232. Deletion size: 843 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0348.4a Homozygous. Outer Left Sequence: ACATCCGGAGCTAAAGCAGA. Outer Right Sequence: CGCCGAGAAAGCAATAGAAC. Inner Left Sequence: TGCTACCTATTGGGTTTCGG. Inner Right Sequence: TGGCCGAGTTTTCTCATCTC. Inner Primer PCR Length: 2928. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K06B9.5. Homozygous. Outer Left Sequence: GGGCAGAACACGAATTTTTC. Outer Right Sequence: GCACATCCCTGGTTGAAACT. Inner Left Sequence: CGCAAATTTGGTCCTGAAAT. Inner Right Sequence: CTCCGCCTACTGTTAGCTCG. Inner Primer WT PCR product: 2959. Deletion size: 1620 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T09A12.4. Homozygous. Outer Left Sequence: GGTATCTGCCTTGTTCTGCC. Outer Right Sequence: GAAACGATGCTCATGCTCAA. Inner Left Sequence: AACCGCGAACAACGAGTTAC. Inner Right Sequence: CAGGGGAACCGCTAGACATA. Inner Primer WT PCR product: 3091. Deletion size: 1317 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C43E11.6. Homozygous. Outer Left Sequence: ATCGCAATTTTCTCCATTCG. Outer Right Sequence: GCGTACTTCTTTCGGAGTGG. Inner Left Sequence: TATTCCGATTCCACACAGCA. Inner Right Sequence: CGATGCGTCAATTTATGTGG. Inner Primer WT PCR Product: 3254. Deletion size: 1032 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T27A10.7. Homozygous. Outer Left Sequence: TCCATGCGAATTGTTGAAAA. Outer Right Sequence: ATCCGCATCTGAATGAGCTT. Inner Left Sequence: TGTCTCCACTGCTAACACGC. Inner Right Sequence: CCGCCCATCAAAAAGATAAA. Inner Primer WT PCR product: 2628. Deletion size: 1242 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K06B9.5. Homozygous. Outer Left Sequence: GGGCAGAACACGAATTTTTC. Outer Right Sequence: GCACATCCCTGGTTGAAACT. Inner Left Sequence: CGCAAATTTGGTCCTGAAAT. Inner Right Sequence: CTCCGCCTACTGTTAGCTCG. Inner Primer WT PCR product: 2959. Deletion size: 712 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C26D10.4. Homozygous. Outer Left Sequence: GTTACTGAATTGCCGTGCCT. Outer Right Sequence: CAAAAGTGTACCGCTGGGTT. Inner Left Sequence: AAAAATCACGAGATTCCGCA. Inner Right Sequence: CATCATCATTGATCGCTTGG. Inner Primer WT PCR Product: 3275. Deletion size: 1473 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y38A10A.5. Homozygous. Outer Left Sequence: TATGGCACTTCGTCAGATGG. Outer Right Sequence: CATTGTCGTAGCAGACGAGC. Inner Left Sequence: TGTCGAGAGGAATCGATGTG. Inner Right Sequence: TTTGCTCTTGTTCGGTTTCA. Inner Primer WT PCR product: 2134. Deletion size: 1287 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R11A5.2. Homozygous. Outer Left Sequence: AATGCTGGCGTTCTCTGTCT. Outer Right Sequence: TGCTGCCTATCGTGAGTTTG. Inner Left Sequence: TGAAATGGAGGATCCCTGAG. Inner Right Sequence: ATTTCGTGTGGGAAATTGGA. Inner Primer WT PCR product: 2183. Deletion size: 1109 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C49C8.4. Homozygous. Outer Left Sequence: CCCCTTGTGCTACGAAAAGA. Outer Right Sequence: CTCCCTTTTCTGACCTGCTG. Inner Left Sequence: AGGTTACGGTATCGGTGCTG. Inner Right Sequence: TTCACTGGCGTGTATTTTGG. Inner Primer WT PCR product: 2871. Deletion size: 1439 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01B10.1. Homozygous. Outer Left Sequence: TTGTTTGAACATCTCGCTGC. Outer Right Sequence: CGGTTTTGGGAGGATGAATA. Inner Left Sequence: TTGGGGCTCACTCTCACTTT. Inner Right Sequence: CCGTAGGGGTGCAAAACTAA. Inner Primer WT PCR product: 3101. Deletion size: 789 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C26E6.9a. Homozygous. Outer Left Sequence: TATAGGTCCCCATGGAGCTG. Outer Right Sequence: GGCCTGAATCAAGAAATGGA. Inner Left Sequence: TGCACGGTGAATGATCAAAT. Inner Right Sequence: CATCGGGAAGCTCTTCTGTC. Inner Primer WT PCR product: 3324. Deletion size: 1269 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R03E9.3. Homozygous. Outer Left Sequence: AAAATGGCGAAAGGGCTAGT. Outer Right Sequence: CGGAACTACGGTAAATGCGT. Inner Left Sequence: GCCGACATTTTGGAAAAGAA. Inner Right Sequence: TTTTGCCGTTCTAGGTGTCC. Inner Primer WT PCR product: 2667. Deletion size: 1196 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R03E9.3. Homozygous. Outer Left Sequence: AAAATGGCGAAAGGGCTAGT. Outer Right Sequence: CGGAACTACGGTAAATGCGT. Inner Left Sequence: GCCGACATTTTGGAAAAGAA. Inner Right Sequence: TTTTGCCGTTCTAGGTGTCC. Inner Primer WT PCR product: 2667. Deletion size: 832 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

E03G2.2. Homozygous. Outer Left Sequence: GCCTGAGATCAACGACTTCC. Outer Right Sequence: CACAAACTATTGGTGTGGCG. Inner Left Sequence: TGTCTTTTGCGAGTCGATTG. Inner Right Sequence: TGTCAAGTTGTCTGCTTGGG. Inner Primer WT PCR Product: 3071. Deletion size: 658 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK829.2. Homozygous. Outer Left Sequence: TCTCGGCATGTTGTTAGCTG. Outer Right Sequence: TTGGCTGCTGTTCTGATACG. Inner Left Sequence: TGAAGAGGAAGCTTTTGGGA. Inner Right Sequence: CCGGAAAAGTCTTGATTGGA. Inner Primer WT PCR Product: 3232. Deletion size: 895 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C49C3.1 Homozygous. Outer Left Sequence: CTATTGTCAGGGACTCGGGA. Outer Right Sequence: TGACATGTTTCCACGGCTTA. Inner Left Sequence: CTGGAGATTTCCGACGAGAG. Inner Right Sequence: CGGGGGTATAGTGGGCTAAT. Inner Primer PCR Length: 3002. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T13F2.1. Homozygous. Outer Left Sequence: AAATACGGTCTTGACACGCC. Outer Right Sequence: CAGGCATTGCGCCTATAAAT. Inner Left Sequence: CGCACACCTTTGCTCATTTA. Inner Right Sequence: AAACAGTAAGCGCATCCACC. Inner Primer WT PCR product: 3114. Deletion size: 715 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C32E12.3. Homozygous. Outer Left Sequence: CGAATATTCCCGAAAAACGA. Outer Right Sequence: CCACGACTTCTCCCTTTCAA. Inner Left Sequence: AATCCCAGTGCAGGCATATC. Inner Right Sequence: ATTTCCAGCACCATTATCGG. Inner Primer WT PCR product: 2824. Deletion size: 983 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C16C10.12. Homozygous. Outer Left Sequence: CGGATTGTCCACTTGAGACC. Outer Right Sequence: TGAAGCAATTTTGTTCAGCG. Inner Left Sequence: GTACGAAGCCGTTCAAAAGC. Inner Right Sequence: GGAGAAGAATGGAACCGTGA. Inner Primer WT PCR product: 3027. Deletion size: 2510 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C36B1.10. Homozygous. Outer Left Sequence: ACAGAGTCGTCTGCTCGGAT. Outer Right Sequence: TCCCTTGGTCTCTGAATCGT. Inner Left Sequence: CGATCTCTTTGGAAACTCGC. Inner Right Sequence: ACCGATGTCTGTTGAAAGCC. Inner Primer WT PCR Product: 3303. Deletion size: 1202 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F22D3.2. Homozygous. Outer Left Sequence: CTTGCCAAATTTGATTGGCT. Outer Right Sequence: ACCAACTTGGCATTTTTCCA. Inner Left Sequence: ACGGTCTCTCGTGTTCTCGT. Inner Right Sequence: TCCGATAACTTCTCGCCAGT. Inner Primer WT PCR Product: 2887. Deletion size: 817 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C09G4.1. Homozygous. Outer Left Sequence: CATAGGCGGTCTAGGAGCAG. Outer Right Sequence: ATGGCGAGCTTTTCTGTCAT. Inner Left Sequence: GCCCCGTAAATAAGCACAAA. Inner Right Sequence: TCGTGTTCTTTCACGTCTCG. Inner Primer WT PCR Product: 2824. Deletion size: 863 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M04F3.4. Homozygous. Outer Left Sequence: GCGAGAAACTGAAGTCGGTC. Outer Right Sequence: ATCCAGCACATCCACAACAA. Inner Left Sequence: GTCAGGAACTGCTCGTAGCC. Inner Right Sequence: ATGGTCAAGCTTCAGCGACT. Inner Primer WT PCR Product: 2480. Deletion size: 328 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807