| RG5035 |
C. elegans |
+/mT1 [umnIs52] II; C16C10.2(gk5524[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5524 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4449 and CGC66. gk5524 is a 957 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TAACTACTTCTTTCGTTCATAGGTCCATTT. Right flanking sequence: CGAGGACATGGCTGGCTGAAAATAATTTTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5036 |
C. elegans |
+/mT1 [umnIs52] II; gop-2(gk5528[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5528 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4453 and CGC66. gk5528 is a 1052 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence:CTATTTTCAGCGTCTCACAGCATTCCTACA ; Right flanking sequence: GAATTTCTGGAGTCGGAGTTGAATTCAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5037 |
C. elegans |
+/mT1 [umnIs52] II; C16A3.6(gk5536[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5536 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VCVC4462 and CGC66. gk5536 is a 1237 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGAAAGATGAAAATAGAGAGAAGGCGCCT; Right flanking sequence: CAAAGGGTCAAGGCATAAAACTTCGCATTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5038 |
C. elegans |
+/mT1 [umnIs52] II; Y37D8A.16(gk5539[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5539 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4466 and CGC66. gk5539 is a 2739 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAAACGCAATTATAAGATCCCTTCGAGATA; Right flanking sequence: GTATACAGTTCCGGTGCATGACTAATGTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5039 |
C. elegans |
lat-1(gk5420[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [umnIs52] II; +/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5420 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4337 and CGC66. gk5420 is a 11293 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CTCTCCTCTATGCTTTCTCTAGTTTTGCCT; Right flanking sequence: GACGGTGCTTCGAATTGATTTGAACAAGCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5041 |
C. elegans |
+/mT1 [umnIs52] II; unc-116(gk5722[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5722 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4653 and CGC66. gk5722 is a 2264 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCTTTGAAATGACGGATTTTTGGACCACAT; Right flanking sequence: CCCGGCTTCTCCTTACAATGCCTGCAATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5042 |
C. elegans |
+/mT1 [umnIs52] II; lars-1(gk5763[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5763 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4694 and CGC66. gk5763 is a 5294 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACGTTAGCCTTGTACACAATAGTACGCCC; Right flanking sequence: TGGCCTAGTTTTGCAATGGCATCGACCGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5043 |
C. elegans |
kars-1(gk5813[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [umnIs52] II; +/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5813 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4745 and CGC66. gk5813 is a 2292 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGAGAGAAAAGCAATAGAGGGGTCTCGCCG; Right flanking sequence: CGGAATTATGGACAAAAAGCGAAAAATCTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5044 |
C. elegans |
gex-3(gk5235[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 [umnIs49] IV; +/ nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5235 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4152 and CGC63. gk5235 is a 2546 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTCGACGTTCGAATATGTACAAGAAAAGTC; Right flanking sequence: TGCTTCATCTGGTCATATGGTTTGGAGTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5045 |
C. elegans |
+/nT1 [umnIs49] IV; vha-13(gk5758[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5758 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4759 and CGC63. gk5758 is a 2243 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCCAGGAAAAGATGGCCGCAGAATCTTCG; Right flanking sequence: CGCTAGATTCTGTTCAGTTTTGCTGAGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5046 |
C. elegans |
iars-1(gk5827[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5827 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4759 and CGC63. gk5827 is a 3755 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CCGTTCCCGACAACATCAATTTTGCCAGAG; Right flanking sequence: GGCGGTCCATCCAACAGTTGACGTGACGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5047 |
C. elegans |
+/ nT1 [umnIs49] IV; vars-1(gk5828[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5828 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4760 and CGC63. gk5828 is a 3391 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGTTTGACAAAAAAATATTTTTTAATCTTC; Right flanking sequence: AGGAACAGTTTCAAGCAAGAATTGCATCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5048 |
C. elegans |
+/mT1 [umnIs52] II; tost-1(gk5543[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5543 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4470 and CGC66. gk5543 is a 1358 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGTTTTATGCACCTCCGTATCACACCACCA; Right flanking sequence: TGTTGCTGTGCTCACGGTCAGCTAAAGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5050 |
C. elegans |
+/mT1 [umnIs52] II; C35D10.5(gk5552[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5552 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4480 and CGC66. gk5552 is a 1321 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAGAAAACCGAAAAATGTTCTCGTTGCTCC; Right flanking sequence: ATTGTTTATACGCGTGTTTCTCTCCACTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5053 |
C. elegans |
+/mT1 [umnIs52] II; C36A4.4(gk5562[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5562 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4490 and CGC66. gk5562 is a 1777 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGAAGACGTCGAAAATAAACTGCTCCAGCT; Right flanking sequence: GGTGGAAAACAATTCAAAAAGTGATAATAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5054 |
C. elegans |
+/mT1 [umnIs52] II; : nlp-48(gk5563[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5563 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4491 and CGC66. gk5563 is a 1026 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAATGGTAAGTTCTTACATAGGCCCCAG; Right flanking sequence: CGTGGATTTTAATATTAAAGTATCGTCCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5056 |
C. elegans |
+/mT1 [umnIs52] II; idhg-1(gk5648[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5648 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4577 and CGC66. gk5648 is a 2420 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAAACACGTGCGGCGCTTGCAAATCAATCG; Right flanking sequence: TTACGTTCTTTTCCTCTGTTTTTTTTTCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5059 |
C. elegans |
'+/mT1 [umnIs52] II; famh-136(hd7024[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick wild-type GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7024 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7027 and CGC66. hd7024 is a 542 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTGAGCTTTAGCTATCTTCCTTTATCCT; Right flanking sequence: ATCACAGGTGTGAAGATTTATTAAATTTTA. sgRNA #1: ATGAATGACGCAAGAATTAA; sgRNA #2: TCTGAATACTTATTGACATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5060 |
C. elegans |
ZK622.4(hd7010[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1[dpy-10(e128) umnIs43] II. Show Description
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick wild-type GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal deletion balanced over mIn1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, arrested GFP+ non-mKate2 (hd7010 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Derived from parental strains VH7029 and CGC53. hd7010 is a 180 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking sequence: ATGGATCCATGTTTCATAAAGGATGTTTTA; Right flanking sequence: ATCAAATCTTCTTTTCTCGCCAAAAACGAA. sgRNA #1: AATGTTGGATTTGCGGAACC; sgRNA #2: CGATGTGGAATTGGATCATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5100 |
C. elegans |
+/nT1 [umnIs49] IV; arp-11(gk5656[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5656 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4586 and CGC63. gk5656 is a 2105 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATCAGCAGCTAATTTTCCATTTTTCCACTC. Right flanking sequence: TCAGCGACTCCAACGTTGATTGAGCAGTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5101 |
C. elegans |
cpt-2(gk5869[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 (gk5869 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4801 and CGC63. gk5869 is a 3129 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CTCTCAATTTTCAGATGCTTCGTTCCTCAA. Right flanking sequence: CGTGGTCACCTTCTCGATCCGAAATAATTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5102 |
C. elegans |
+/nT1 [umnIs49] IV; sluh-7(gk5704[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5704 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4635 and CGC63. gk5704 is a 2339 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAATAAATCCAGATCAAGAAAACATGACGT. Right flanking sequence: GGCGGTAAGTTCTGCTTATAAGACGCCATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5103 |
C. elegans |
ampd-1(gk5139[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mIn1 [dpy-10(e128) umnIs43] II. Show Description
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (L1-L2 stage lethal), and non-GFP mKate2+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4065 and CGC53. gk5139 is a 5156 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAAAAGTCTGATGAAGATTCTGAGCCACCA. Right flanking sequence: TACCAATGTTCCAGATATTCGTGTCAGCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5105 |
C. elegans |
+/mT1 [umnIs52] II; mrpl-44(gk5627[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Apparent homozygous lethal or sterile deletion balanced over labeled mT1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, GFP+ non-mKate2 gk5627 homozygotes, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4556 and CGC66. gk5627 is a deletion of 2142 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GATGGGAGGACAAAGAGCAAAGCGGAGATG. Right flanking sequence: ATATTTCCGGTGCTCCAATTCTGTGTCCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5106 |
C. elegans |
+/mT1 [umnIs52] II; eif-3.D(gk5753[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Apparent homozygous lethal or sterile deletion balanced over labeled mT1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+ heterozygotes, GFP+ non-mKate2 gk5753 homozygotes, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. [NOTE: there is also red fluorescence apparent in the hypodermis or body wall.] Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4684 and CGC66. gk5753 is a deletion of 2118 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCGAATACAAGAAATTGTCAGAAACCGGGG. Right flanking sequence: GACGCCACCTCAATTTTTGGTTTTTATTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5107 |
C. elegans |
rps-5(gk5776[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5776 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4707 and CGC63. gk5776 is a 882 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGAAAACAAATAGTATGAACAAACAATAC. Right flanking sequence: ATAACAACTTCAGTATAGTTTAAAAAATGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5108 |
C. elegans |
Y71H2AM.20(gk5290[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Apparent homozygous lethal or sterile deletion balanced over labeled sC1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+ heterozygotes, GFP+ non-mKate2 gk5290 homozygotes (Let), and Dpy mKate2+ sC1 homozygotes. Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4205 and CGC51. gk5290 is a deletion of 2953 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CAGATTCGACGACAGATGACGAATGGACGG. Right flanking sequence: CACGGATTCAGGTCGAACACATTTTTAATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5109 |
C. elegans |
sbds-1(gk5584[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Apparent homozygous lethal or sterile deletion balanced over labeled sC1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+ heterozygotes, GFP+ non-mKate2 gk5584 homozygotes (Let), and Dpy mKate2+ sC1 homozygotes. Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4513 and CGC51. gk5584 is a deletion of 1745 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTGAGATCCAAAAAGAATTCTCGGGTGTGT. Right flanking sequence: ATTGGTCAGAACTTTCTGATTTGTCGGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5110 |
C. elegans |
perm-1(gk5785[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [umnIs52] II; +/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Apparent homozygous lethal or sterile deletion balanced over labeled mT1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, GFP+ non-mKate2 gk5627 homozygotes, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4716 and CGC66. gk5785 is a deletion of 1919 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CGGGAAATCTGTTTTAAAAATGTTTGCCCG. Right flanking sequence: TTTTCCAATAATCCAATACCCATTTAATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5111 |
C. elegans |
+/mT1 [umnIs52] II; wah-1(gk5392[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Apparent homozygous lethal or sterile deletion balanced over labeled mT1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, GFP+ non-mKate2 gk5392 homozygotes, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4309 and CGC66. gk5392 is a deletion of 9220 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGTTTACACGCCCACCAATCTTCCCCGCCC. Right flanking sequence: TTCGGACCTTCACTGGATGTAGCTCGGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RSL111 |
C. elegans |
rab-3(ftw74[rab-3::SL2::LoxP::GFP::dpy-10::LoxP(inv)]) II. Show Description
rab-3(ftw74[rab-3::SL2::LoxP::GFP::dpy-10::LoxP(inv)]) II. Endogenous locus co-expresses GFP by trans-splicing using CRISPR-Cas9. Green fluorescence visible in neurons by dissection fluorescence microscopy. dpy-10 CRISPR/Cas9 entry site is located downstream of the GFP coding region. Inverted LoxP sites flank the GFP::dpy-10 insert. Please contact Ryan Littlefield prior to publishing work using this strain.
|
|
| RSL123 |
C. elegans |
dpy-10(cn64) rab-3(ftw79) II. Show Description
rab-3(ftw79[rab-3::SL2::LoxP::GFP::NLS::3'UTR::Abeta(inv)::sigPep(inv)::T2A(inv)::wrmScarlet11(inv)::LoxP(inv)]) II. Modified endogenous rab-3 locus co-expresses stochastic, switchable cassette by trans-splicing using CRISPR-Cas9. Green fluorescence visible in neurons by dissection fluorescence microscopy. Inverted LoxP sites flank the GFP-NLS and inverted wrmScarlet11::T2A::signalPeptide::Abeta insert. Please contact Ryan Littlefield prior to publishing work using this strain.
|
|
| RW12164 |
C. elegans |
ceh-20(st12164[ceh-20::GFP + loxP + unc-119(+) + loxP] unc-119(tm4063) III. Show Description
ceh-20(st12164[ceh-20::GFP + loxP + unc-119(+) + loxP].
|
|
| RW12167 |
C. elegans |
zfh-2(st12167[zfh-2::GFP + loxP + unc-119(+) + loxP] I; unc-119(tm4063) III. Show Description
zfh-2(st12167[zfh-2::GFP + loxP + unc-119(+) + loxP] I.
|
|
| RW12170 |
C. elegans |
ceh-10(st12170[ceh-10::GFP + loxP + unc-119(+) + loxP]) unc-119(tm4063) III. Show Description
ceh-10(st12170[ceh-10::GFP + loxP + unc-119(+) + loxP]) III.
|
|
| RW12173 |
C. elegans |
egl-44(st12173[egl-44::GFP + loxP + unc-119(+) + loxP]) II; unc-119(tm4063) III. Show Description
egl-44(st12173[egl-44::GFP+loxP+unc-119(+) loxP]) II.
|
|
| RW12174 |
C. elegans |
hlh-26(st12174[hlh-26::GFP + loxP + unc-119(+) + loxP] II; unc-119(tm4063) III. Show Description
hlh-26(st12174[hlh-26::GFP + loxP + unc-119(+) + loxP] II.
|
|
| RW12175 |
C. elegans |
ast-1(st12175[ast-1::GFP + loxP + unc-119(+) + loxP] II; unc-119(tm4063) III. Show Description
ast-1(st12175[ast-1::GFP + loxP + unc-119(+) + loxP] II.
|
|
| RW12178 |
C. elegans |
lin-26(st12178[lin-26::GFP + loxP + unc-119(+) + loxP] II; unc-119(tm4063) III. Show Description
lin-26(st12178[lin-26::GFP + loxP + unc-119(+) + loxP] II.
|
|
| SU875 |
C. elegans |
mig-10(jc53[mig-10::mNeonGreen::3xFlag + LoxP]) III. Show Description
Endogenously tagged mig-10. No growth, behavior, or morphological defects observed. Reference: Serre JM & Hardin J. (2022) The Lamellipodin homologue MIG-10 is not essential for dorsal intercalation in the embryonic epidermis of the C. elegans embryo. microPublication Biology. 10.17912/micropub.biology.000522.
|
|
| SU955 |
C. elegans |
tes-1(jc71[mNG::tes-1 + LoxP]) IV. Show Description
mNeonGreen and FLAG tags inserted into endogenous tes-1 locus by CRISPR/Cas9 genome editing. Reference: Lynch AM, et al. Curr Biol. 2022 Dec 5;32(23):5189-5199.e6. doi: 10.1016/j.cub.2022.10.045. PMID: 36384139.
|
|
| SV1361 |
C. elegans |
unc-119(ed3) III; heIs105 IV. Show Description
heIs105 [rps-27::loxP::NLS::mCherry::let858 UTR::loxP::NLS::GFP::let-858 UTR + unc-119(+)] IV. Strain is viable at 15-25 C. heIs105 carries a read-out construct which allows the visualization of the CRE lox mediated recombination by a switch from red to green. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
|
|
| SV1440 |
C. elegans |
unc-119(ed3) III; heIs105 IV; heSi141 X. Show Description
heIs105 [rps-27::loxP::NLS::mCherry::let858 UTR::loxP::NLS::GFP::let-858 UTR + unc-119(+)] IV. heSi141 [hlh-8(short)::FLAG::CRE::tbb-2 + unc-119(+)] X. Maintain at 15-25C. Expression of CRE recombinase in the mesoblast lineage driven by the hlh-8 promoter. heIs105 carries a read-out construct which allows the visualization of the CRE lox mediated recombination in the mesoblast lineage by a switch from red to green. This read-out construct is silenced in the germline. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
|
|
| SV1448 |
C. elegans |
fzr-1(ku298) II; unc-119(ed3) III; heSi143 IV; heSi141 X. Show Description
heSi 143 [rps-27::loxP::mCherry::let-858::fzr-1p::fzr-1::fzr-1 UTR::loxP::GFP::let-858 UTR + unc-119(+)] IV. heSi141 [hlh-8(short)::FLAG::CRE::tbb-2 + unc-119(+)] X. Maintain at 15-25C. Expression of CRE recombinase in the mesoblast lineage driven by the hlh-8 promoter. heSi143 rescues fzr-1(ku298). fzr-1 will be excised upon mesoblast-specific expression of CRE, creating a mesoblast specific mutant of fzr-1. This recombination event can be visualized by a switch from red to green in those cells (the mesoblast) were fzr-1 is lost. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
|
|
| SV1450 |
C. elegans |
unc-119(ed3) III; heIs145 IV Show Description
heIs145 [rps-27::loxP::NLS::mCherry::let858 UTR::eft-3::tagBFP::tbb-2 UTR::loxP::NLS::GFP::let-858 UTR + unc-119(+)] IV. Maintain at 15-25C. heIs145 expresses a read-out construct used to visualize CRE activity and specificity, and to test whether CRE expression is likely to induce loss of a gene of interest (tagBFP in this case) in a given tissue. Expression of CRE will result in a change from mCherry to GFP and loss of tagBFP expression in those cells where CRE is active. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
|
|
| SV1578 |
C. elegans |
unc-119(ed3) III; heIs105 IV; swsn-1(os22) heSi164 V; heSi141 X. Show Description
heIs105 [rps-27::loxP::NLS::mCherry::let858 UTR::loxP::NLS::GFP::let-858 UTR + unc-119(+)] IV. heSi164 [rps-27::loxN::NLS::mCherry::let858 UTR::swsn-1p::swsn-1::unc-54 UTR::loxN::NLS::GFP::let-858 UTR + unc-119(+)] V. heSi141 [hlh-8(short)::FLAG::CRE::tbb-2 + unc-119(+)] X. Maintain the line at 15C and shift to 25C for mutant analysis. Expression of CRE recombinase in the mesoblast lineage driven by the hlh-8 promoter. heSi164 carries a swsn-1 rescue construct which ensures rescue of the temperature-sensitive swsn-1(os22) mutation. Upon expression of CRE (in this case in the mesoblast lineage) the swsn-1 gene will be excised, creating a mesoblast specific mutant of swsn-1. This recombination event can be visualized by a switch from red to green in those mesoblast cells in which swsn-1 was lost. The animals are healthy at 15C, but embryonic lethal and larval arrested at 23-25C. swsn-1(os22) causes mild overproliferation in the mesoblast lineage. The swsn-1 rescuing transgene is unable to rescue germline development of swsn-1(os22) mutants. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
|
|
| SV1871 |
C. elegans |
swsn-4(he268 he272 [LoxN start + LoxN intron 5]) IV; heSi208 V; heSi141 X. Show Description
heSi208 [eft- 3p::LoxP::NLS(egl-13)::tagBFP2::tbb-2 UTR::LoxP::NLS(egl-13)::mCherry::tbb-2 3'UTR] V. heSi141 [hlh-8p::CRE] X. Egg laying defective. LoxN sites in the endogenous swsn-4 locus facilitate inducible knockout of swsn-4. he268 he272 homozygotes are Egl since they cannot form a functioning vulva due to swsn-4 inactivated in the mesoderm lineage by hlh-8p::CRE expression. Reference: van der Vaart A, et al. Sci Adv 2020 May 20;6(21):eaay3823. PMID: 32494730
|
|
| SV1930 |
C. elegans |
swsn-8(he273 he287 [LoxN exon 3 + LoxN last intron]) I; heSi208 V; heSi141 X. Show Description
heSi208 [eft- 3p::LoxP::NLS(egl-13)::tagBFP2::tbb-2 UTR::LoxP::NLS(egl-13)::mCherry::tbb-2 3'UTR] V. heSi141 [hlh-8p::CRE] X. he273 he287 homozygotes are Egl since they cannot form a functioning vulva due to swsn-8 inactivated in the mesoderm lineage by hlh-8p::CRE expression. LoxN sites in the endogenous swsn-8 locus facilitate inducible knockout of swsn-8. Reference: van der Vaart A, et al. Sci Adv 2020 May 20;6(21):eaay3823. PMID: 32494730
|
|
| SV2002 |
C. elegans |
rnt-1(he305[rnt-1::eGFP::3xflag::loxP]) I. Show Description
eGFP and 3xFlag tags inserted into endogenous rnt-1 locus. Superficially wild-type. Reference: Horst SEM, et al. Development 2019 Nov 18;146(22):dev180034.
|
|
| SV2114 |
C. elegans |
pop-1(he335[eGFP::loxP::pop-1]) I. Show Description
eGFP tag inserted into endogenous pop-1 locus. The homozygous gfp::pop-1 strain is viable, although not fully healthy and occasionally missing a seam cell. Reference: Horst SEM, et al. Development 2019 Nov 18;146(22):dev180034.
|
|