Search Strains

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5520 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4445 and CGC66. gk5520 is a 1322 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAGGTCGCAGAAGAACATTGACCCCAGCTC; Right flanking sequence: GAAGAGATAAAACGAAAGCTAAGATTGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5524 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4449 and CGC66. gk5524 is a 957 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TAACTACTTCTTTCGTTCATAGGTCCATTT. Right flanking sequence: CGAGGACATGGCTGGCTGAAAATAATTTTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5528 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4453 and CGC66. gk5528 is a 1052 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence:CTATTTTCAGCGTCTCACAGCATTCCTACA ; Right flanking sequence: GAATTTCTGGAGTCGGAGTTGAATTCAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5536 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VCVC4462 and CGC66. gk5536 is a 1237 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGAAAGATGAAAATAGAGAGAAGGCGCCT; Right flanking sequence: CAAAGGGTCAAGGCATAAAACTTCGCATTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5539 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4466 and CGC66. gk5539 is a 2739 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAAACGCAATTATAAGATCCCTTCGAGATA; Right flanking sequence: GTATACAGTTCCGGTGCATGACTAATGTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5420 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4337 and CGC66. gk5420 is a 11293 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CTCTCCTCTATGCTTTCTCTAGTTTTGCCT; Right flanking sequence: GACGGTGCTTCGAATTGATTTGAACAAGCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5722 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4653 and CGC66. gk5722 is a 2264 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCTTTGAAATGACGGATTTTTGGACCACAT; Right flanking sequence: CCCGGCTTCTCCTTACAATGCCTGCAATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5763 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4694 and CGC66. gk5763 is a 5294 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACGTTAGCCTTGTACACAATAGTACGCCC; Right flanking sequence: TGGCCTAGTTTTGCAATGGCATCGACCGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5813 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4745 and CGC66. gk5813 is a 2292 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGAGAGAAAAGCAATAGAGGGGTCTCGCCG; Right flanking sequence: CGGAATTATGGACAAAAAGCGAAAAATCTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5235 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4152 and CGC63. gk5235 is a 2546 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTCGACGTTCGAATATGTACAAGAAAAGTC; Right flanking sequence: TGCTTCATCTGGTCATATGGTTTGGAGTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5758 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4759 and CGC63. gk5758 is a 2243 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCCAGGAAAAGATGGCCGCAGAATCTTCG; Right flanking sequence: CGCTAGATTCTGTTCAGTTTTGCTGAGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5827 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4759 and CGC63. gk5827 is a 3755 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CCGTTCCCGACAACATCAATTTTGCCAGAG; Right flanking sequence: GGCGGTCCATCCAACAGTTGACGTGACGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5828 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4760 and CGC63. gk5828 is a 3391 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGTTTGACAAAAAAATATTTTTTAATCTTC; Right flanking sequence: AGGAACAGTTTCAAGCAAGAATTGCATCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5543 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4470 and CGC66. gk5543 is a 1358 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGTTTTATGCACCTCCGTATCACACCACCA; Right flanking sequence: TGTTGCTGTGCTCACGGTCAGCTAAAGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5552 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4480 and CGC66. gk5552 is a 1321 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAGAAAACCGAAAAATGTTCTCGTTGCTCC; Right flanking sequence: ATTGTTTATACGCGTGTTTCTCTCCACTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5562 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4490 and CGC66. gk5562 is a 1777 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGAAGACGTCGAAAATAAACTGCTCCAGCT; Right flanking sequence: GGTGGAAAACAATTCAAAAAGTGATAATAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5563 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4491 and CGC66. gk5563 is a 1026 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAATGGTAAGTTCTTACATAGGCCCCAG; Right flanking sequence: CGTGGATTTTAATATTAAAGTATCGTCCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5648 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4577 and CGC66. gk5648 is a 2420 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAAACACGTGCGGCGCTTGCAAATCAATCG; Right flanking sequence: TTACGTTCTTTTCCTCTGTTTTTTTTTCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick wild-type GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7024 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7027 and CGC66. hd7024 is a 542 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTGAGCTTTAGCTATCTTCCTTTATCCT; Right flanking sequence: ATCACAGGTGTGAAGATTTATTAAATTTTA. sgRNA #1: ATGAATGACGCAAGAATTAA; sgRNA #2: TCTGAATACTTATTGACATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick wild-type GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal deletion balanced over mIn1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, arrested GFP+ non-mKate2 (hd7010 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Derived from parental strains VH7029 and CGC53. hd7010 is a 180 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking sequence: ATGGATCCATGTTTCATAAAGGATGTTTTA; Right flanking sequence: ATCAAATCTTCTTTTCTCGCCAAAAACGAA. sgRNA #1: AATGTTGGATTTGCGGAACC; sgRNA #2: CGATGTGGAATTGGATCATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5656 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4586 and CGC63. gk5656 is a 2105 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATCAGCAGCTAATTTTCCATTTTTCCACTC. Right flanking sequence: TCAGCGACTCCAACGTTGATTGAGCAGTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 (gk5869 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4801 and CGC63. gk5869 is a 3129 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CTCTCAATTTTCAGATGCTTCGTTCCTCAA. Right flanking sequence: CGTGGTCACCTTCTCGATCCGAAATAATTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (L1-L2 stage lethal), and non-GFP mKate2+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4065 and CGC53. gk5139 is a 5156 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAAAAGTCTGATGAAGATTCTGAGCCACCA. Right flanking sequence: TACCAATGTTCCAGATATTCGTGTCAGCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Apparent homozygous lethal or sterile deletion balanced over labeled mT1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, GFP+ non-mKate2 gk5627 homozygotes, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4556 and CGC66. gk5627 is a deletion of 2142 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GATGGGAGGACAAAGAGCAAAGCGGAGATG. Right flanking sequence: ATATTTCCGGTGCTCCAATTCTGTGTCCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

wIs78 [SCMp::GFP + ajm-1p::GFP + F58E10 (cosmid) + unc-119(+)] IV. GFP expression in seam cells and adherens junctions. Check periodically for GFP in seam cells to retain robust expression. ajm-1 previously called jam-1. Derived by outcrossing JR1000. It is not know whether the ced-1(e1735) or unc-119(ed4) mutations are still present, as the array rescues both phenotypes. wIs78 males do not mate very well; heterozygotes mate fine.

uthSi17 [myo-3p::MLS::GFP::unc-54 3’UTR + Cbr-unc-119(+)] I. Single-copy insertion. MLS::GFP reporter uses myo-3 promoter and atp-1 mitochondrial localization sequence; localizes to mitochondrial matrix in body-wall muscle cells. Derived by out-crossing parental strain AGD1664 (EG6701 background) to N2. Reference: Kim J, et al. J Vis Exp. 2025 Jan 17:(215). doi: 10.3791/67610. PMID: 39895615.

uthSi83 [col-19p::MLS::GFP(65C)::unc-54 3'UTR + Cbr-unc-119(+)] I. Single-copy insertion. MLS::GFP reporter uses col-19 promoter and atp-1 mitochondrial localization sequence; localizes to mitochondrial matrix in hypodermal cells beginning in late L4 stage. Derived by out-crossing parental strain AGD2837 (EG6701 background) to N2. Reference: Kim J, et al. J Vis Exp. 2025 Jan 17:(215). doi: 10.3791/67610. PMID: 39895615.

uthSi80 [vha-6p::MLS::GFP(65C)::unc-54 3'UTR + Cbr-unc-119(+)] IV. Single-copy insertion. MLS::GFP reporter uses vha-6 promoter and atp-1 mitochondrial localization sequence; localizes to mitochondrial matrix in intestinal cells. Derived by out-crossing parental strain AGD2805 (EG6703 background) to N2. Reference: Kim J, et al. J Vis Exp. 2025 Jan 17:(215). doi: 10.3791/67610. PMID: 39895615.

ynIs34 [flp-19p::GFP] IV. Him. Transcriptional flp-19 reporter. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785. Clark SG & Chiu C. Development. 2003 Aug;130(16):3781-94. Kim K & Li C. J Comp Neurol. 2004 Aug 2;475(4):540-50.

N-terminal GFP::TEV::AID*::FLAG tag inserted into endogenous unc-31 locus using CRISPR/Cas9. crRNA (TTTTCAGGAGGATCATGATT). Reference: Cornell R, et al. J Neurosci. 2022 Oct 26;JN-RM-1368-22. doi: 10.1523/JNEUROSCI.1368-22.2022. PMID: 36302635

reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor with N-terminal GFP::TEV::AID*::FLAG tag inserted into endogenous unc-31 locus using CRISPR/Cas9 can be used for conditional depletion of UNC-31 in the nervous system. crRNA (TTTTCAGGAGGATCATGATT). Reference: Cornell R, et al. J Neurosci. 2022 Oct 26;JN-RM-1368-22. doi: 10.1523/JNEUROSCI.1368-22.2022. PMID: 36302635. NOTE: PCR detection of reSi7 insert using the published primers has been reported to be defective. These primers designed by Sherlyn Wijaya and Claire Richardson to detect ttTi4338 (LG I) also work for reIs7: ttTi4338 (LG I) wrdSi23-F: cttcaaagaaatcgccgac wrdSi23-FP: AACAACGAGACCTACGTCG wrdSi23-R: Ctctaagatgtcggccac (wt ~300bp, mutant ~650bp).

rpIs3 [gcy-33p::GFP]. vsIs33 [dop-3::RFP] V. Loss of BAG neuron specification. egl-46(rp4) is a point mutation that causing a single amino acid change (C185Y) in the zinc finger domain of EGL-46; it behaves like a null for BAG specification phenotypes.

jsIs1 [(pSB120) snb-1::GFP + rol-6(su1006)]. Roller Unc.

mdEx790 [cho-1p(7.6kb)::cho-1::GFP + pha-1(+) + pBluescript]. CHO-1 translational fusion driven by 7.6 kb cho-1 promoter rescues cho-1 mutant behaviors, including reduced initial thrashing rate, fatigue, and synthetic interactions with pmt-2. Strong fluorescence in nerve ring, and ventral and dorsal nerve cords. Structure of the transgene is shown in Figure 1 of Mullen et al., 2007.

trIs113 [abu-14p::abu-14::GFP + rol-6(su1006)]. Rollers. Integrated line generated from an extrachromosomal array provided by David Raizen. References: George-Raizen JB, et al. Biol Open. 2014 Oct 31;3(11):1139-49. PMID: 25361578. Kamal M, et al. bioRxiv 2022.04.11.487937; doi: https://doi.org/10.1101/2022.04.11.487937.

GFP tag inserted in endogenous unc-94 locus; specifically tags UNC-94A isoform. Green fluorescence is visible by compound microscopy as striations in body wall muscles, as elongated puncta in single-sarcomere (anal depressor, uterine, and vulval) muscles, as well as the cell bodies of two neurons. Not visible on fluorescent dissection microscopes. Modifcation of the endogenous myo-3 loci by the insertion of a trans-splicing ICR region and worm-optimized mCherry at region encoding the head-neck junction. Bright red fluorescence is visible as striations in body wall muscles and clusters in single-sarcomere (anal depressor, vuvla, uterine) muscles. Please contact Ryan Littlefield prior to publishing work using this strain.

rpl-13(ftw73[rpl-13::SL2::GFP::dpy-10]) I. Endogenous locus co-expresses GFP by trans-splicing using CRISPR-Cas9. Green fluorescence visible thoughout body by dissection fluorescence microscopy. D10 (dpy-10) CRISPR/Cas9 entry site is located downstream of the GFP coding region. Please contact Ryan Littlefield prior to publishing work using this strain.

GFP tag inserted in endogenous unc-94 locus; specifically tags UNC-94A isoform. Green fluorescence is visible by compound microscopy as striations in body wall muscles, as elongated puncta in single-sarcomere (anal depressor, uterine, and vulval) muscles, as well as the cell bodies of two neurons. Not visible on fluorescent dissection microscopes. Outcrossed parental strain RSL3 with N2. Please contact Ryan Littlefield prior to publishing work using this strain.

rab-3(ftw74[rab-3::SL2::LoxP::GFP::dpy-10::LoxP(inv)]) II. Endogenous locus co-expresses GFP by trans-splicing using CRISPR-Cas9. Green fluorescence visible in neurons by dissection fluorescence microscopy. dpy-10 CRISPR/Cas9 entry site is located downstream of the GFP coding region. Inverted LoxP sites flank the GFP::dpy-10 insert. Please contact Ryan Littlefield prior to publishing work using this strain.

Endogenous rpl-13 locus modified using CRISPR-Cas0 to co-express GFP::SYNZIP fusion by trans-splicing. Green fluorescence visible thoughout body. Off-target background mutation might be present resulting in reduced progeny. Please contact Ryan Littlefield prior to publishing work using this strain.

rab-3(ftw79[rab-3::SL2::LoxP::GFP::NLS::3'UTR::Abeta(inv)::sigPep(inv)::T2A(inv)::wrmScarlet11(inv)::LoxP(inv)]) II. Modified endogenous rab-3 locus co-expresses stochastic, switchable cassette by trans-splicing using CRISPR-Cas9. Green fluorescence visible in neurons by dissection fluorescence microscopy. Inverted LoxP sites flank the GFP-NLS and inverted wrmScarlet11::T2A::signalPeptide::Abeta insert. Please contact Ryan Littlefield prior to publishing work using this strain.

unc-54(ftw19[NLS::mCherry::SL2::GFP::unc-54]) I. myo-3(ftw16[NLS::GFP::SL2::mCherry::myo-3]) V. Endogenous unc-54 locus tagged with NLS::GFP and mCherry using CRISPR/Cas9; coexpressed from the endogenous promoter using trans-splicing. Body muscles have bright green fluorescence within myofibrils and bright red nuclei visible by dissection fluorescence microscopy. Slow movement and slightly impaired egg-laying. Endogenous myo-3 locus tagged with NLS::GFP and mCherry using CRISPR/Cas9; coexpressed from the endogenous promoter using trans-splicing. Please contact Ryan Littlefield prior to publishing work using this strain.

Endogenous tni-3 locus tagged with mCherry using CRISPR/Cas9. GFP-nls coexpressed from the endogenous promoter using SL2 trans-splicing. Visible using fluorescent dissecting microscopes. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain.

GFP tag inserted in endogenous unc-94 locus; specifically tags UNC-94A isoform. mCherry tag inserted into endogenous tni-3 locus; GFP::NLS coexpressed from the endogenous tni-3 promoter via SL2 trans-splicing. GFP::UNC-94 is visible by compound microscopy as striations in body wall muscles, as elongated puncta in single-sarcomere (anal depressor, uterine, and vulval) muscles, as well as the cell bodies of two neurons. GFP::UNC-94 is not visible on fluorescent dissection microscopes. Please contact Ryan Littlefield prior to publishing work using this strain.

Endogenous myo-3 locus tagged with mCherry using CRISPR/Cas9. nls-GFP coexpressed from the endogenous promoter using trans-splicing. Visible using fluorescent dissecting microscopes. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain.

GFP tag inserted in endogenous unc-94 locus; specifically tags UNC-94A isoform. mCherry tag inserted into endogenous myo-3 locus; GFP::NLS coexpressed from the endogenous myo-3 promoter via SL2 trans-splicing. GFP::UNC-94 is visible by compound microscopy as striations in body wall muscles, as elongated puncta in single-sarcomere (anal depressor, uterine, and vulval) muscles, as well as the cell bodies of two neurons. GFP::UNC-94 is not visible on fluorescent dissection microscopes. Please contact Ryan Littlefield prior to publishing work using this strain.

Endogenous locus tagged with GFP using CRISPR/Cas9. NLS-mCherry co-expressed from the endogenous promoter using trans-splicing. Body muscles have bright green fluorescence within myofibrils and bright red nuclei visible by dissection fluorescence microscopy. Slow movement and slightly impaired egg-laying. Please contact Ryan Littlefield prior to publishing work using this strain.

GFP tag inserted into endogenous pat-3 locus; mCherry coexpressed from the endogenous pat-3 promoter via SL2 trans-splicing. mCherry tag inserted into endogenous pat-2 locus; GFP::NLS coexpressed from the endogenous pat-2 promoter via SL2 trans-splicing. Please contact Ryan Littlefield prior to publishing work using this strain.

Endogenous locus tagged with GFP using CRISPR/Cas9. Body muscles are visibly green by dissection fluorescence microscopy. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain.

Endogenous locus tagged with GFP using CRISPR/Cas9. Body muscles are visibly green by dissection fluorescence microscopy except for the BWMs near the head. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain.