Homozygous viable. Deletion of 1346 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: agcacataaaaatctacaaaaagatcacca ; Right flanking sequence: cctggaaaagttgatctgtgagaagtggca. sgRNA #1: GGAGGAAGAGGAATAAgaag; sgRNA #2: tttggcggggaaaaatgacc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Endogenous tni-3 locus tagged with mCherry using CRISPR/Cas9. GFP-nls coexpressed from the endogenous promoter using SL2 trans-splicing. Visible using fluorescent dissecting microscopes. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain.

GFP tag inserted in endogenous unc-94 locus; specifically tags UNC-94A isoform. mCherry tag inserted into endogenous tni-3 locus; GFP::NLS coexpressed from the endogenous tni-3 promoter via SL2 trans-splicing. GFP::UNC-94 is visible by compound microscopy as striations in body wall muscles, as elongated puncta in single-sarcomere (anal depressor, uterine, and vulval) muscles, as well as the cell bodies of two neurons. GFP::UNC-94 is not visible on fluorescent dissection microscopes. Please contact Ryan Littlefield prior to publishing work using this strain.