| PHX2015 |
C. elegans |
ceh-58(syb2015[ceh-58::GFP]) II. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-58 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| PHX2517 |
C. elegans |
ceh-86(syb2517[ceh-86::GFP::FLAG]) II. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-86 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| PHX2587 |
C. elegans |
wac-1.1&wac-1.2(syb2587) I. Show Description
Superficially wild-type. Deletion removes of wac-1.1/Y40B1A.1 and wac-1.2/Y40B1A.3 (I:13344075 to 13358647, version WS276, PRJNA13758).
|
|
| PHX2634 |
C. elegans |
flp-3(syb2634[flp-3::T2A::3XNLS::GFP]) X. Show Description
GFP tag inserted at the C-terminus of the endogenous flp-3 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Tekieli T. et al. Development. 2021 Sep 15;148(18):dev199687. doi: 10.1242/dev.199687. PMID: 34415309.
|
|
| PHX2878 |
C. elegans |
ric-4(syb2878[ric-4::T2A::3xNLS::GFP]) V. Show Description
T2A::3xNLS::GFP tag inserted at the C-terminus of the endogenous ric-4 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
|
|
| PHX2880 |
C. elegans |
ceh-16(syb2709[loxP] syb2880[ceh-16::loxP::GFP]) III. Show Description
GFP tag inserted at the C-terminus of the endogenous ceh-16 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
|
|
| PHX2934 |
C. elegans |
ceh-37(syb2933[loxP]) ceh-36(syb2934[ceh36::loxP::GFP]) X. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
|
|
| PHX3072 |
C. elegans |
rab-3(syb3072[rab-3::T2A::3xNLS::GFP]) II. Show Description
T2A::3xNLS::GFP tag inserted at the C-terminus of the endogenous rab-3 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
|
|
| PHX3186 |
C. elegans |
nlp-3 (syb3186 [nlp-3::T2A::3XNLS::GFP]) X. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-3 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3195 |
C elegans |
flp-33(syb3195[flp-33::T2A::3xNLS::GFP]) I. Show Description
GFP tag inserted into endogenous flp-33 locus using CRISPR/Cas9 engineering. GFP expression in ADE (in head). Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095.
|
|
| PHX3203 |
C. elegans |
flp-6 (syb3203 [flp-6::T2A::3XNLS::GFP]) V. Show Description
GFP tag inserted at the C-terminus of the endogenous flp-6 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
|
|
| PHX3208 |
C. elegans |
nlp-40(syb3208 [nlp-40::T2A::3XNLS::GFP]) I. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-40 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3212 |
C. elegans |
flp-21(syb3212 [flp-21::T2A::3×NLS::GFP]) V. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
|
|
| PHX3225 |
C elegans |
jkk-1(syb3225) X. Show Description
Putative jkk-1 gain-of-function allele. Reference: Busack I & Bringmann H. (2023). JKK-1(3E), a JKK-1 mutant with predicted phosphomimetic amino acid substitutions. microPublication Biology. 10.17912/micropub.biology.000785.
|
|
| PHX3238 |
C. elegans |
nlp-42(syb3238[nlp-42::T2A::3XNLS::GFP]) V. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
|
|
| PHX3252 |
C. elegans |
unc-10(syb2898 syb3252[unc-10::T2A::3xNLS::GFP]) X. Show Description
T2A::3xNLS::GFP tag inserted at the C-terminus of the endogenous unc-10 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
|
|
| PHX3277 |
C. elegans |
flp-13 (syb3277 [flp-13::T2A::3XNLS::GFP]) IV. Show Description
GFP tag inserted at the C-terminus of the endogenous flp-13 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3285 |
C. elegans |
nlp-54(syb3285 [nlp-54::T2A::3xNLS::GFP]) IV. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-54 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3293 |
C. elegans |
bli-2(syb3293[bli-2::mNG]) II. Show Description
mNeonGreen tag inserted at C-terminus of endogenous bli-2 locus. Superficially wild-type with green fluorescence in L4 epidermis and adult stage cuticle. Reference: Adams JRG, et al. Nat Commun. 2023 Nov 18;14(1):7506. doi: 10.1038/s41467-023-43058-9. PMID: 37980413.
|
|
| PHX3306 |
C. elegans |
nlp-62(syb3306[nlp-62::T2A::3XNLS::GFP]) I. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-62 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3426 |
C. elegans |
ceh-27(syb2714[loxP] syb3286[loxP] syb3426[ceh27::GFP]) V. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
|
|
| PHX3601 |
C elegans |
pah-1(syb3601) II. Show Description
Superficially wild-type; decreased production of serotonin-derived metabolites; increase in exploration. CRISPR-mediated deletion removing 1450 bp spans Exon 1 to Exon 6. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT.
|
|
| PHX3634 |
C elegans |
pah-1(syb3634[GFP::H2B::T2A::pah-1]) II. Show Description
Superficially wild-type. GFP tag inserted into endogenous pah-1 locus by CRISPR/Cas9.
|
|
| PHX3691 |
C. elegans |
sqt-3(syb3691[sqt-3::mNG(int)]) V. Show Description
mNeonGreen tag inserted into endogenous sqt-3 locus between CFCS and collagen domains. GCCTACGGAGGACCAGAAGTCAACC -> GCCTACGGAGGA^CCAGAAGTCAACC. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.
|
|
| PHX3936 |
C. elegans |
nlp-51(syb3936[nlp-51::SL2::GFP::H2B]) II. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-51 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933.
|
|
| PHX4122 |
C. elegans |
tsp-6(syb4122[tsp-6::wrmScarlet]) X. Show Description
wrmScarlet tag inserted at C-terminus of endogenous tsp-6 locus. wrmScarlet expression in ciliated neurons provides a useful marker to track ciliary production of extracellular vesicles. Reference: Razzauti A & Laurent P. Elife. 2021 Sep 17:10:e67670. doi: 10.7554/eLife.67670. PMID: 34533135.
|
|
| PHX4373 |
C. elegans |
nova-1(syb4373[nova-1::GFP]) V. Show Description
GFP tag inserted at the C-terminus of the endogenous nova-1 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
|
|
| PHX4376 |
C. elegans |
rbm-25(syb4376[rbm-25::GFP]) V. Show Description
GFP tag inserted at the C-terminus of the endogenous rbm-25 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
|
|
| PHX4399 |
C. elegans |
nlp-82(syb4399[nlp-82::SL2::GFP::H2B]) II. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-82 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX4406 |
C. elegans |
nlp-73(syb4406 [nlp-73::SL2::GFP::H2B]) V. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-73 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
|
|
| PHX4413 |
C. elegans |
flp-27(syb4413 [flp-27::SL2::GFP::H2B]) II. Show Description
GFP tag inserted at the C-terminus of the endogenous flp-27 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933.
|
|
| PHX4421 |
C. elegans |
trh-1(syb4421[trh-1::SL2::GFP::H2B]) IV. Show Description
CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. Elife. 2022 Mar 24:11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425.
|
|
| PHX4426 |
C. elegans |
ehs-1(syb4426[ehs-1::SL2::GFP::H2B]) II. Show Description
SL2::GFP::H2B tag inserted at the C-terminus of the endogenous ehs-1 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
|
|
| PHX4440 |
C. elegans |
npr-37(syb4440[npr-37::SL2::GFP::H2B]) IV. Show Description
GFP tag inserted at the C-terminus of the endogenous npr-37 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Cros C & Hobert O. Proc Natl Acad Sci USA. 2022 Sep 13;119(37):e2206817119. doi: 10.1073/pnas.2206817119. PMID: 36067313.
|
|
| PHX4453 |
C. elegans |
trhr-1(syb4453[trhr-1::SL2::GFP::H2B]) I. Show Description
CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. Elife. 2022 Mar 24:11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425.
|
|
| PHX4478 |
C. elegans |
egl-3(syb4478[egl-3::SL2::GFP::H2B]) V. Show Description
SL2::GFP::H2B tag inserted at the C-terminus of the endogenous elg-3 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
|
|
| PHX4491 |
C. elegans |
unc-17(syb4491[unc-17::T2A::GFP::H2B]) IV. Show Description
CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
|
|
| PHX4502 |
C. elegans |
ser-7(syb4502[ser-7::SL2::GFP::H2B]) X. Show Description
CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
|
|
| PHX4513 |
C. elegans |
flp-5(syb4513[flp-5::SL2::GFP::H2B]) X. Show Description
CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. Elife. 2022 Mar 24:11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425.
|
|
| PHX4677 |
C. elegans |
kin-36(syb4677[GFP::HIS::SL2::kin-36]) IV. Show Description
CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
|
|
| PHX4678 |
C. elegans |
ceh-30(syb4678[ceh-30::GFP]) X. Show Description
GFP tag inserted at the C-terminus of the endogenous ceh-30 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
|
|
| PHX4698 |
C. elegans |
cat-2(syb4698[cat-2::T2A::NeonGreen]) II. Show Description
NeonGreen tag inserted into endogenous cat-2 locus. NeonGreen expression in dopaminergic neurons. Superficially wild type. Reference: Jimeno-Martín A, et al. Genome Res. 2022 Mar;32(3):459-473. PMID: 35074859.
|
|
| PHX4729 |
C. elegans |
rig-6(syb4729[rig-6::SL2::GFP::H2B]) II. Show Description
CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
|
|
| PHX4763 |
C. elegans |
rig-3(syb4763[rig-3::SL2::GFP::H2B]) X. Show Description
CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
|
|
| PHX4799 |
C. elegans |
ceh-38(syb4799[ceh-38::GFP]) II. Show Description
GFP tag inserted at the C-terminus of the endogenous ceh-38 locus by CRISPR. Allele generated by SUNY Biotech.
|
|
| PHX4861 |
C. elegans |
gpla-1(syb4861[flr-2::SL2::GFP::H2B]) V. Show Description
CRISPR/Cas9-engineered reporter allele. gpla-1 formerly known as flr-2. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
|
|
| PHX4895 |
C. elegans |
htrl-1(syb4895[htrl-1::SL2::GFP::H2B]) V. Show Description
CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
|
|
| PHX4901 |
C. elegans |
ceh-41(syb4901[ceh-41::GFP]) X. Show Description
GFP tag inserted at the C-terminus of the endogenous ceh-41 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
|
|
| PHX5073 |
C elegans |
ceh-43(syb5073[ceh-43::SL2::GFP::H2B]) III. Show Description
GFP tag inserted into endogenous ceh-43 locus using CRISPR/Cas9 engineering. GFP expression in IL1, CEP, AIN, AIZ, ASJ, ADE, BDU, SDQ, PDE, PVQ, and possibly glia. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095.
|
|
| PHX530 |
C. elegans |
nlp-11(syb530) II. Show Description
Superficially wild-type. syb530 is a 2042 bp deletion of the entire nlp-11 gene. Flanking sequences: tatttctcctattgagtgcaaaaaagagtgaaa-acatcaacaaataaaataccataccaacgagt Primers for genotyping: Fwd: gtcctcaccattcccctagg Interal (fwd): TCTGATCGACGCTGGAAAGA Rev: gaataggaagagggcggagg PCR product: WT 264 bp / syb530 -- ; WT 2551 bp / syb530 509 bp. Reference: Konietzka J, et al. Curr Biol. 2020 Jan 6;30(1):1-16.e13. doi: 10.1016/j.cub.2019.10.048. PMID: 31839447
|
|
