RB2030 |
C. elegans |
nlp-3(ok2688) X. Show Description
F48C11. Homozygous. Outer Left Sequence: ATACCCGCCATCATCTCAAA. Outer Right Sequence: TATTTCGGTATCTGCCGAGC. Inner Left Sequence: TCAGCAGCACTTGACAAACA. Inner Right Sequence: AAAATGTTCTTGACGCGGAG. Inner Primer PCR Length: 3211 bp. Deletion Size: 1618 bp. Deletion left flank: AACCCAAGTTGCTACAAATCATTTGAAACA. Deletion right flank: TGCTTACAATGAACAATTGTGTCCCGGATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
LX2004 |
C. elegans |
vsIs183 lite-1(ce314) lin-15B&lin-15A(n765) X. Show Description
vsIs183 [nlp-3p::GCaMP5::nlp-3 3'UTR + nlp-3p::mCherry::nlp-3 3'UTR + lin-15(+)] X. Integrated transgene using nlp-3 promoter to drive GCaMP5 and mCherry expression in HSN; useful for visualizing and quantitating calcium influx in HSN. Reference: Collins K, et al. Elife. 2016 Nov 16;5. pii: e21126. doi: 10.7554/eLife.21126.
|
|
PHX3186 |
C. elegans |
nlp-3 (syb3186 [nlp-3::T2A::3XNLS::GFP]) X. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-3 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
HA341 |
C. elegans |
lin-15B&lin-15A(n765) X; rtEx235. Show Description
rtEx235 [nlp-3p::GFP + lin-15(+)]. Maintain at 20C or warmer. Pick GFP+ non-Muv to maintain. Reference: Nathoo AN, et al. Proc Natl Acad Sci U S A. 2001 Nov 20;98(24):14000-5.
|
|
HBR1899 |
C elegans |
goeIs406. Show Description
goeIs406 [hsp-16.2p::nlp-31::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-31::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
HBR1902 |
C. elegans |
goeIs409. Show Description
goeIs409 [hsp-16.2p::nlp-32::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-32::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
LSC59 |
C. elegans |
nlp-37(tm4393) X; lstEx24. Show Description
lstEx24 [pdf-2p::pdf-2::3'UTR + elt-2p::GFP]. Pick GFP+ animals to maintain. lst24 rescues pdf-2; wild-type locomotion. Reference: Meelkop E, et al. Mol Cell Endocrinol. 2012 Sep 25;361(1-2):232-40.
|
|
OH15487 |
C. elegans |
otIs695. Show Description
otIs695 [nlp-3p::GFP + lin-15(+)]. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
|
|
PHX1446 |
C. elegans |
nlp-8(syb762) I; nlp-32(syb431) cnc- 6(syb393) III, Y43C5A.3(syb761) IV; sybDf2 sybDf1 cnc-10(syb937) nlp-25(syb579) cnc-7(syb558) V. Show Description
Reduced survival after wounding. PHX1446 carries knockouts of 19 members of the nlp and cnc peptide families. sybDf1 is a deletion of a gene cassette including nlp-34, nlp-31, nlp-30, nlp-29, nlp-28, and nlp-27. sybDf2 is a deletion of a gene cassette including cnc-11, cnc-1, cnc-5, cnc-4, cnc-3, and cnc-2. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
PS8687 |
C. elegans |
nlp-32(sy1459) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-32.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: GCTACTTGTATTCTGTCTTATCGCATTGACCGCCT
right flanking sequence: TGCCGGTTTTCTCTTTTCCAAATGGGCTAACTATG
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAAAGAGAAAACCGGCAAGG
Method Reference: G3 (Bethesda).
|
|
PS8689 |
C. elegans |
nlp-33(sy1461) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-33.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: GCTTCTCTTTGCCATATTGGCTATCGTTGATGCCCA
right flanking sequence: GTGGGGATgtaagttttcaataacttgtttctg
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCTATCGTTGATGCCCAGTG
Method Reference: G3 (Bethesda).
|
|
VC2357 |
C. elegans |
nlp-38(ok2330) I. Show Description
C01A2.7. External left primer: CGTAAGCATGCCGAAGTTTT. External right primer: GGAATTTGGCATGGAAGTGT. Internal left primer: CCAGCTGGAAATTTTTGGAA. Internal right primer: GGCGGGAAATTCAACTTTTT. Internal WT amplicon: 2632 bp. Deletion size: approximately 1000 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|