Search Strains

Fertile Unc-38. sy326 has no phenotype on its own. Suppresses sterility of let-23(sy10) and lin-3(n1058). Sterile in double mutant combination with lfe-1 alleles. Do not distribute this strain; other labs should request it from the CGC.

Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC.

Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC.

Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC.

Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC.

Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC.

syEx234 [let-23::GFP + pBS + (pMH86) dpy-20(+)]. Non-Dpys bear the transgene and express GFP in multiple cells including the pn.ps and uv1. Maintain by picking Non-Dpy. Do not distribute this strain; other labs should request it from the CGC.

syIs46 [dpy-30::S65T::lacI + hsp-16p::GFP::lacI + dpy-20(+)] II. Animals are Ncl, Him and Non-Dpy. Heat shock results in diffuse nuclear GFP expression from Fire Lab vector pPD49.78::LacI in most cells. Also see some consitutive GFP expression in embryos from dpy-30 promoter. Do not distribute this strain; other labs should request it from the CGC.

syIs80 [(pPGF11.13) lin-11::GFP + unc-119(+)] III. GFP expression in developing vulval cells, VCs and uterine pi lineage cells. Received new stock 9/2003. Do not distribute this strain; other labs should request it from the CGC. Received new strain from Bhagwati Gupta on April 7, 2008.

syEx475 [myo-3p::unc-68(see following comments) + myo-2p::GFP + pUC-19]. Pick GFP+ animals to maintain. myo-3p::unc-68 transgene was produced by injecting pEM23 (myo-3 promoter + unc-68 exons 1-8) + 18 kb unc-86 PCR fragment (start codon through nucleotide 18090) + pLM511 (unc-68 position 11989 to the end); fragments were recombined in vivo.

syIs103[unc-119(+) + pPGF11.13(lin-11::GFP)]. GFP fluoresence is observed in the vulva, uterine pi cells and VC neurons. Do not distribute this strain; other labs should request it from the CGC.

syIs53 [pPGF11.07(lin-11::GFP) + unc-119(+)] V. GFP expression in developing vulval cells and VC neurons. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are weak Muv and segregate weak Muv, Muv Twitchers, and Dpy Vuls whose progeny are larval lethal. sy100 is a dominant negative allele of let-60. n1046 is a gain-of-function allele of let-60. Do not distribute this strain; other labs should request it from the CGC.

syIs317 [nlp-40p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript].  nlp-40 cGAL driver for intestine.  NOTE: Incorrectly annotated as being on LG III in paper; actually should be on LG II.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs406 [15xUAS::?pes-10::GFP::H2B::let-858 3'UTR + ttx-3p::RFP + pBlueScript].  GFP::H2B effector.  Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs407 [15xUAS::?pes-10::GFP::H2B::let-858 3'UTR + ttx-3p::RFP + pBlueScript].  GFP::H2B cGAL effector.  Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs409 [15xUAS::?pes-10::mCherry::H2B::let-858 3'UTR + unc-122p::GFP + pBlueScript].  mCherry::H2B cGAL effector.  Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

Superficially wild-type. a weak allele for C53C9.2 ; 58 bp insertion from downstream sequence of its own and 1 bp deletion (leading to change of an animo acid and insertion of 19 amino acids in frame); balanced with FX30326, further confimed by genotyping for homozygotes of C53C9.2 Left flanking sequence ACCGCTGTCGGTATGCCACGTTGGAATATCACCAAG; Right flanking sequence: ACAAGAAGCAAGGATACATCGCTCCAGATCAGAGATCTG; inserted sequence between the two flanking sequence: CTCGGAGAAGACATTCTCCGACGAGGAACCGAATTCACACCATGGTACTCTGGACAAA. sgRNA : GTATCCTTGCTTCTTGTCCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Dumpy. Viable allele of let-23. Vul. Do not distribute this strain; other labs should request it from the CGC.

Unc. Viable allele of let-23. Vul. Do not distribute this strain; other labs should request it from the CGC.

Lineage defects in B, F & U blast cells resulting in abnormal spicules and ectopic spicule cells. F34D10.5 rescues lin-48(sy234); it encodes a C2H2 zinc finger protein similar to Drosophila ovo. Do not distribute this strain; other labs should request it from the CGC.

myIs4 [pkd-2p::pkd-2::GFP + unc-122p::GFP]. Phenotypically normal. sid-2::mScarlet is functional in environmental RNAi. Reference: Nikonorova IA, et al. Curr Biol. 2022 Mar 19;S0960-9822(22)00396-7. PMID: 35334227

Superficially WT.

Superficially WT.

Bacteria. E. coli harboring the plasmid PB255, which uses the lin-31 promoter variant to express the lin-31::VP16 chimeric gene. It is particularly useful for the expression of heterologous genes in the vulval precursor cells. PB255 possesses three main components : an enhancer, a promoter region, a multi-cloning site (MCS), and a 3' UTR derived from the unc-54 gene. [CGC note: The plasmid in this strain was constructed from pBS II KS(+) and is likely Amp-R, but Amp-R has not been confirmed]. Biosafety Level: BSL-1.

Male-female strain. Low fecundity and fitness. PX439 is an inbred derivative of isofemale line PB259 originally collected from a forest in Ohio (USA) by Scott Baird (Wright State University). Reference: Fierst JL, et al. PLoS Genet. 2015 Jun 26;11(6):e1005323. doi: 10.1371/journal.pgen.1005323. PMID: 26114425.

Inbred strain with low fecundity and fitness. Originally collected in Wuhan, China. Reference: Adams PE, et al. Mol Biol Evol. 2023 Mar 4;40(3):msad039. doi: 10.1093/molbev/msad039. PMID: 36807460.

fxDf1 (II: 2,484,339 - 2,487,244) removes nspf-1, nspf-2, and nspf-3. Him. This strain carries a knockout of the Nematode-Specific Peptide family, group F (NSPF) gene family, which localizes to sperm membranous organelles. There are no effects on spermatogenesis, male fertility, or sperm competitive ability. Hermaphrodites produce approximately 30% males. Reference: Kasimatis KR, et al. (2018) BioRxiv 290221; doi: https://doi.org/10.1101/290221.

fxSi1 [pie-1p::TIR-1::mRuby::unc-54 3' UTR + loxP, I: 2851003] I. Degron tag was inserted into the endogenous spe-44 locus in the JU2526 wild isolate background, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Reference: Kasimatis, KR et al. (2020) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605

fxIs47 [rps-0p::5’ (delta)HygR::GCGAAGTGACGGTAGACCGT::3’ (delta)HygR::unc-54 3’::LoxP, II:8420157]. Phenotypically wild-type strain carrying a landing pad for barcode integrations. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.

Temperature-sensitive allele of osm-3. Restrictive temperature 30C. Can be maintained at 20C. Reference: Philbrook A, et al. PLoS Biol. 2024 Nov 26;22(11):e3002892. doi: 10.1371/journal.pbio.3002892. PMID: 39591402.

oyIs96 [gcy-8p::FlincG3 gcy-8p::myr::TagRFP + unc-122p::dsRed]. Red fluorescence in coelomocytes and faint green fluorescence in AFD head neurons. cGMP fluorescent sensor (FlincG3) expression in AFD neurons allows visualization of AFD signaling. Generated in N2 background. Reference: Extrachromosomal array used in the generation of this strain detailed in https://doi.org/10.1534/genetics.119.302392.

Previously called sns-10(oy42).

Previously called sns-10(oy56).

Superficially wild-type. Reduced dauer formation in response to specific ascarosides. Reference: Kim K, et al. Science. 2009 Nov 13;326(5955):994-8.

Superficially wild-type. Reduced dauer formation in response to specific ascarosides. Reference: Kim K, et al. Science. 2009 Nov 13;326(5955):994-8.

ytEx100 [mel-47(3245 bp rescuing fragment) + rol-6(su1006)]. Maintain by picking Rollers. Animals which have lost the transgene look wt but are fully penetrant Mel. Mutant embryos arrest with less than 100 cells.

ytEx209 contains [mel-46(+) + sur-5::GFP]. Maintain by picking GFP+. Culture at 20°C or higher in order not to lose the transgene. GFP minus worms are Mel or sterile at 25 C (completely penetrant). Strong but not fully penetrant Mel at 15 C. To start a yt5 homozygous culture transfer several GFP minus worms to 15°C.

etEx2 [glo-1p::GFP::ras-2 CAAX + rol-6(su1006)]. Rollers. Pick Rollers to maintain. etEx2 contains plasmid pQC09.6, which carries the ras-2 CAAX motif at the C-terminus of GFP; this array is a prenylation reporter. Reference: Mörck C, et al. Proc Natl Acad Sci U S A. 2009 Oct 27;106(43):18285-90.

Gain-of-function atfs-1 allele. Reference: Rauthan M, et al. Proc Natl Acad Sci U S A. 2013 Apr 9;110(15):5981-6.

Gain-of-function atfs-1 allele. Reference: Rauthan M, et al. Proc Natl Acad Sci U S A. 2013 Apr 9;110(15):5981-6.

Gain-of-function atfs-1 allele. Reference: Rauthan M, et al. Proc Natl Acad Sci U S A. 2013 Apr 9;110(15):5981-6.

Gain-of-function atfs-1 allele. Reference: Rauthan M, et al. Proc Natl Acad Sci U S A. 2013 Apr 9;110(15):5981-6.

paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. ech-7(et6) suppresses the cold-adaptation defect of paqr-2(tm3410) and partially suppresses the tail tip defect. ech-7(et6); paqr-2(tm3410) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.

paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. nhr-49(et7) is a gain-of-function allele and suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. nhr-49(et7); paqr-2(tm3410) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.

paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. nhr-49(et8) is a gain-of-function allele and suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. nhr-49(et8); paqr-2(tm3410) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.

paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. nhr-49(et13) is a gain-of-function allele and suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. nhr-49(et13); paqr-2(tm3410) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.

paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. mdt-15(et14) is a gain-of-function allele and suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. mdt-15(et14); paqr-2(tm3410) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.

Superficially wild-type. Slight decrease in brood size and locomotion speed. Reference: Svensson E, et al. PLoS One. 2011;6(6):e21343.

The mdt-15(et14) gain-of-function mutation has no obvious phenotype on its own but can act as a paqr-2 suppressor. The C5832666T [WS200] mutation can be detected by PCR using the following primers: mdt-15(et14) Mut Fwd: 5’-GTGCCTCCAGATCCACAGCT-3’; mdt-15(et14) WT Fwd: 5’-GTGCCTCCAGATCCACAGCC-3’; mdt-15 Rev: 5’-CACCCATTGGAGCACCACT-3’. Annealing 65°C, expected product ~400 bp. Reference: Svensk E, et al. PLoS Genetics 9:e1003801. PMID: 24068966