More Fields
Strain Species Genotype
VC1241 C. elegans skr-1(ok1696) I. Show Description
F46A9.5. Superficially wild type. External left primer: AATCCGTAAGGAAAACGCCT. External right primer: AGTGTTTTCGGAAATGGCAC. Internal left primer: CACTGCCAGCTGACACAACT. Internal right primer: CGCAGAATTTGAACACGTTG. Internal WT amplicon: 2194 bp. Deletion size: 1740 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
CU6102 C. elegans skr-1(sm151) I; unc-76(e911) V. Show Description
sm151 is a semi-dominant allele of skr-1. Maintain under normal conditions. Reference: Killian DJ, et al. (2008) Dev Biol. 322(2):322-31.
RG3064 C. elegans skr-17(ve564[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 718 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: agggtgttttaaaatttgaatttgccgccg ; Right flanking sequence: ATGGGATGATTAAttttctgttactatctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC3031 C. elegans skr-10(ok3719) IV. Show Description
Y105C5B.13. External left primer: CTTGACGGCATTTCTCATCA. External right primer: CATCGCACAAAATTGCAAAC. Internal left primer: ACTTTTTGAACAAACGCAGC. Internal right primer: CGCAAAAGTGGCATGGTATT. Internal WT amplicon: 1292 bp. Deletion size: 741 bp. Deletion left flank: TCAAATGATGGAACAGTTTTCGAAATCAGT. Deletion right flank: AAGTTTTTATTTAACCAAAAGCAATTACGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807