| PHX4678 |
C. elegans |
ceh-30(syb4678[ceh-30::GFP]) X. Show Description
GFP tag inserted at the C-terminus of the endogenous ceh-30 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
|
|
| PHX4689 |
C. elegans |
nep-2(syb4689[gfp::h2b::sl2::nep-2]) II. Show Description
SL2::GFP::H2B tags inserted at N-terminus of nep-2 endogenous locus. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995.
|
|
| PHX4799 |
C. elegans |
ceh-38(syb4799[ceh-38::GFP]) II. Show Description
GFP tag inserted at the C-terminus of the endogenous ceh-38 locus by CRISPR. Allele generated by SUNY Biotech.
|
|
| PHX4901 |
C. elegans |
ceh-41(syb4901[ceh-41::GFP]) X. Show Description
GFP tag inserted at the C-terminus of the endogenous ceh-41 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
|
|
| PHX5014 |
C. elegans |
col-63::mNG(syb5014) I. Show Description
mNG inserted at C-terminus of endogenous col-63 locus.
|
|
| PHX5033 |
C. elegans |
rol-1::mNG(syb5033) II. Show Description
mNG inserted at C-terminus of endogenous rol-1 locus.
|
|
| PHX509 |
C. elegans |
nhr-67(syb509[nhr-67::gfp]) IV. Show Description
GFP reporter inserted into C-terminus of endogenous nhr-67 locus. Reference: Medwig-Kinney TN, et al. Development. 2020 Jan 2;147(1).
|
|
| PHX5270 |
C. elegans |
ctns-1(syb5270[ctns-1::wrmScarlet]) II. Show Description
wrmScarlet tag inserted at C-terminus of endogenous stns-1 locus. Lysosomal marker. Reference: Ngale Njume F, et al. iScience. 2022 Oct 14;25(11):105357. doi: 10.1016/j.isci.2022.105357. PMID: 36339267.
|
|
| PHX530 |
C. elegans |
nlp-11(syb530) II. Show Description
Superficially wild-type. syb530 is a 2042 bp deletion of the entire nlp-11 gene. Flanking sequences: tatttctcctattgagtgcaaaaaagagtgaaa-acatcaacaaataaaataccataccaacgagt Primers for genotyping: Fwd: gtcctcaccattcccctagg Interal (fwd): TCTGATCGACGCTGGAAAGA Rev: gaataggaagagggcggagg PCR product: WT 264 bp / syb530 -- ; WT 2551 bp / syb530 509 bp. Reference: Konietzka J, et al. Curr Biol. 2020 Jan 6;30(1):1-16.e13. doi: 10.1016/j.cub.2019.10.048. PMID: 31839447
|
|
| PHX5321 |
C. elegans |
bli-4(syb5321[bli-4::SfGFP(int)]) I. Show Description
bli-4 translational reporter. SfGFP inserted in endogenous locus in 3rd exon of BLI-4 between Pro and peptidase domains. CAGCAGCCACAGTCTCCACGAGAA -> CAGCAGCCACAG^TCTCCACGAGAA. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.
|
|
| PHX5349 |
C. elegans |
tpan-1(syb5349[tpan-1::GFP]) V. Show Description
GFP tag inserted at the C-terminus of the endogenous tpan-1 locus by CRISPR. Allele generated by SUNY Biotech.
|
|
| PHX5400 |
C. elegans |
golg-5(syb5400[golg-5::wrmScarlet]) I. Show Description
wrmScarlet tag inserted at the C-terminus of the endogenous golg-5 locus by CRISPR. Broad punctate expression. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX5406 |
C. elegans |
nep-2(syb5406[GFPnovo2::nep-2]) II. Show Description
GFPnovo2 inserted at N-terminus of endogenous nep-2 locus. Expression in muscle, including uterine and vulval muscles, as well as several neurons and other tissues. Reference: Lo J, et al. Curr Biol. 2024 Oct 21;34(20):4715-4728.e4. doi: 10.1016/j.cub.2024.09.059. PMID: 39395417.
|
|
| PHX5437 |
C elegans |
cone-1(syb5437[gfp::cone-1]) III. Show Description
GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. Broad punctate expression of GFP. Allele generated by SUNY Biotech. [NOTE: Previously described as ceh-44(syb5437[gfp::ceh-44]) III. ceh-44 and cone-1 are located in the same locus and may share many exons, but are two separate genes with different functions and expression patterns. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX5500 |
C elegans |
ceh-44(syb5500[ceh-44::oxGFP]) III. Show Description
oxGFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. Broad punctate expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX5536 |
C. elegans |
ins-9(syb5536[ins-9::SL2::gfp::H2B]) X. Show Description
GFP tag inserted at the C-terminus of the endogenous ins-9 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.
|
|
| PHX5697 |
C. elegans |
nlp-2(syb5697 [nlp-2::SL2::GFP::H2B]) X. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-2 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933.
|
|
| PHX5704 |
C. elegans |
gbb-1(syb5704[gbb-1::sl2::gfp::h2b]) X. Show Description
SL2::GFP::H2B tags inserted at C-terminus of gbb-1 endogenous locus. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995.
|
|
| PHX5759 |
C. elegans |
gbb-2(syb5759[gbb-2::sl2::gfp::h2b]) IV. Show Description
SL2::GFP::H2B tags inserted at C-terminus of gbb-2 endogenous locus. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995.
|
|
| PHX5791 |
C. elegans |
pop-1(syb5791[GFP::AID*::GGGGSGSGS linker::pop-1]) I. Show Description
GFP and AID* tags inserted at the N-terminus of the endogenous pop-1 locus by CRISPR. Insertion includes a GGGGSGSGS linker sequence between the tags and POP-1. Generated in N2 background.
|
|
| PHX5792 |
C. elegans |
pll-1(syb5792[pll-1::sl2::gfp::h2b]) III. Show Description
SL2::GFP::H2B tags inserted at C-terminus of pll-1 endogenous locus. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995.
|
|
| PHX5804 |
C. elegans |
egl-3(syb5804[flag::NLS::Cre::SL2::egl-3]) V. Show Description
Cre inserted into the endogenous egl-3 locus by CRISPR. Pan-neuronal expression of Cre. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX5843 |
C elegans |
ceh-44(syb5843[ceh-44::gfp(exon8)]) III. Show Description
GFP tag inserted at the N-terminus of the endogenous ceh-44 locus by CRISPR. Pan-neuronal nuclear expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX5859 |
C. elegans |
ceh-48(syb5859[flag::NLS::Cre::SL2::ceh-48]) IV. Show Description
Cre inserted into the endogenous ceh-48 locus by CRISPR. Pan-neuronal expression of Cre. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX5866 |
C. elegans |
flp-11(syb5866) X. Show Description
Molecular null allele. syb5866 is a CRISPR-engineered deletion of the entire flp-11 coding region. Strongly reduces sleep. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.
|
|
| PHX6073 |
C. elegans |
tol-1(syb6073[Q712A,Y713A,G714A,N715A]) I. Show Description
Reduced brood size; high rates of embryonic and larval arrest. CRISPR/Cas9-engineered mutation of residues that mediate interaction with TOL-1 receptor in development. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.
|
|
| PHX6123 |
C. elegans |
T07A9.10(syb6123[T07A9.10::SL2::GFP::H2B) IV. Show Description
GFP tag inserted at the C-terminus of the endogenous T07A9.10 locus by CRISPR. Punctate ubiquitous expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX6153 |
C. elegans |
latd-1(syb6153[latd-1::GFP) X. Show Description
C39D10.6. GFP tag inserted at the C-terminus of the endogenous latd-1 locus by CRISPR. Punctate GFP expression in pharynx and excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX6281 |
C elegans |
ceh-44(syb6281[ceh-44::gfp(exon7)]) III. Show Description
GFP tag inserted at exon 7 of the endogenous ceh-44 locus by CRISPR. Nuclear pan-neuronal nuclear and broad punctate expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX6304 |
C. elegans |
syx-3(syb6304[syx-3::SL2::GFP::H2B]) X. Show Description
GFP tag inserted at the C-terminus of the endogenous syx-3 locus by CRISPR. Ubiquitous expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX6325 |
C. elegans |
unc-13(syb6325[unc-13::SL2::GFP::H2B) I. Show Description
GFP tag inserted at the C-terminus of the endogenous unc-13 locus by CRISPR. Nuclear neuronal and hypodermal expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX6333 |
C. elegans |
dmsr-1(syb6331 syb6333[FRT::dmsr-1 exons 2-3::FRT]) V. Show Description
Conditional knockout of dmsr-1 created via consecutive insertion of two FRT sites (GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC) flanking the second and third exons. The sequence within the two FRT sites is predicted to encode the first four transmembrane alpha helices. FLP recombination excises this sequence and introduces a frameshift, resulting in a likely molecular null allele of dmsr-1. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.
|
|
| PHX6345 |
C. elegans |
W02D7.3(syb6345[GFP::W02D7.3]) V. Show Description
GFP tag inserted at the N-terminus of the endogenous W02D7.3 locus by CRISPR. Expression of GFP in pharynx, excretory gland cell, and some additional cells in the head. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX6377 |
C.elegans |
uncp-18(syb6377) IV. Show Description
T07A9.10. syb6377 deletion removes all but exon 1 and part of exon 2 of uncp-18 locus. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX6394 |
C. elegans |
Y71G12B.26(syb6394[Y71G12B.26::GFP]) I. Show Description
GFP tag inserted at the C-terminus of the endogenous Y71G12B.26 locus by CRISPR. Expression of GFP in pharynx and excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX6466 |
C. elegans |
F36D1.23(syb6466[F36D1.23::tagRFP]) I. Show Description
tagRFP tag inserted at the C-terminus of the endogenous F36D1.23 locus by CRISPR. Strong and specific expression of GFP in excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX6499 |
C elegans |
unc-75(syb6499[gfp::unc-75]) I. Show Description
GFP tag inserted at the N-terminus of the endogenous unc-75 locus by CRISPR. Pan-neuronal nuclear expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX6541 |
C. elegans |
spex-2(syb6541[spex-2::SL2::GFP]) I. Show Description
GFP tag inserted at the C-terminus of the endogenous spex-2/F36D1.7 locus by CRISPR. Expression of GFP in excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX6547 |
C elegans |
golg-4(syb6547[wrmScarlet::golg-4]) III. Show Description
wrmScarlet tag inserted at the N-terminus of the endogenous golg-4 locus by CRISPR. Broad punctate wrmScarlet expression. Allele generated by SUNY Biotech. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170.
|
|
| PHX6640 |
C. elegans |
cdh-5(syb6640[cdh-5::GFP]) IV. Show Description
SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-5 locus.
|
|
| PHX6670 |
C. elegans |
spig-2(syb6670[spig-2::SL2::GFP::H2B]) V. Show Description
SL2::GFP::H2B cassette inserted directly before the stop codon of the endogenous spig-2 locus. spig-2 also known as txt-17 or F20A1.10. Reference: Aguilar GR & Hobert O. (2024). A protocol to transform a fluorescent reporter from a nuclear to a cytoplasmic location. microPublication Biology. https://doi.org/10.17912/micropub.biology.000954
|
|
| PHX6680 |
C elegans |
golg-2(syb6680[wrmScarlet::golg-2]) II. Show Description
wrmScarlet tag inserted at the N-terminus of the endogenous golg-2 locus by CRISPR. Broad punctate wrmScarlet expression. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX6739 |
C.elegans |
unc-64(syb6739[unc-64::SL2::GFP::H2B) III. Show Description
GFP tag inserted at the C-terminus of the endogenous unc-64 locus by CRISPR. Ubiquitous expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX6764 |
C. elegans |
cdh-4(syb6764[cdh-4::GFP]) III. Show Description
SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-4 locus.
|
|
| PHX6773 |
C. elegans |
hlh-17 hlh-31(syb6635) hlh-32(syb6773) IV. Show Description
Triple mutant for hlh-17, hlh-31, and hlh-32. CRISPR/Cas9-engineered 1691 bp deletion of the entire hlh-32 locus in hlh-17 hlh-31(syb6635) double mutant parental strain. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
|
|
| PHX6862 |
C. elegans |
ifet-1(syb6862[ifet-1(del CHD)::mMaple *dfw15]) III. Show Description
Deletion of the cup homology domain (CHD; 196-217aa) in the endogenously-tagged ifet-1 locus; mMaple tag inserted at the C-terminus. Reference: Bhatia P, et al. Life Sci Alliance. 2025 May 29;8(8):e202503387. doi: 10.26508/lsa.202503387. PMID: 40441896.
|
|
| PHX6886 |
C.elegans |
ifet-1(syb6862[ifet-1(del PolyQ)::mMaple *dfw15]) III. Show Description
Deletion of the Poly Q region (PolyQ; 527-644aa) in the endogenously-tagged ifet-1 locus; mMaple tag inserted at the C-terminus. Reference: Bhatia P, et al. Life Sci Alliance. 2025 May 29;8(8):e202503387. doi: 10.26508/lsa.202503387. PMID: 40441896.
|
|
| PHX6898 |
C elegans |
cone-1(syb6898 [cone-1::T2A::GFP::H2B]) III. Show Description
GFP tag inserted at C-terminus of endogenous cone-1 locus by CRISPR. Broad nuclear GFP expression in non-neuronal cells. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX6949 |
C elegans |
ifet-1(syb6949[ifet-1(del NLS)::mMaple *dfw15]) III. Show Description
Deletion of the Nuclear Localization Sequence (NLS; 220-235aa) in the endogenously-tagged ifet-1 locus; mMaple tag inserted at the C-terminus. No embryonic viability defect in hermaphrodites. Reference: Bhatia P, et al. Life Sci Alliance. 2025 May 29;8(8):e202503387. doi: 10.26508/lsa.202503387. PMID: 40441896.
|
|
| PHX6954 |
C.elegans |
ifet-1(syb6862[ifet-1(del CC)::mMaple *dfw15]) III. Show Description
Deletion of the coiled coil domain (CC; 664-691aa) in the endogenously-tagged ifet-1 locus; mMaple tag inserted at the C-terminus. Reference: Bhatia P, et al. Life Sci Alliance. 2025 May 29;8(8):e202503387. doi: 10.26508/lsa.202503387. PMID: 40441896.
|
|
