| GW1623 |
C. elegans |
arle-14(gw1623[GFP::TEV::3xFLAG::arle-14]) met-2(gw1419[met-2::FLAG::TEV::mCherry]) III. Show Description
Superficially wild-type. Endogenously tagged met-2 and arle-14 loci. MET-2::mCherry and GFP::ARLE-14 signal are detectable in all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265
|
|
| GW304 |
C. elegans |
unc-119(ed3) III; gwIs28. Show Description
gwIs28 [myo-3::mCherry + 256xlacO + unc-119(+)]. Superficially wild-type. Contains a small lacO array co-integrated with a muscle specific mCherry reporter (~10x smaller than the gwIs4 array). Reference: Meister P, et al. Genes Dev. 2010 Apr 15;24(8):766-82. PMID: 20395364
|
|
| GW398 |
C. elegans |
gwIs39 gwIs34 unc-119(ed3) III. Show Description
gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs34 [myo-3::mCherry + 256xlacO + unc-119(+)] III. Superficially wild-type. Expresses GFP-LacI throughout development from early embryogenesis, forming a small spot at the lacO array. Worms have red muscle (from L1 stage) and green intestine (from late L4 stage). Reference: Meister P, et al. Genes Dev. 2010 Apr 15;24(8):766-82. PMID: 20395364
|
|
| GW421 |
C. elegans |
gwIs39 III; gwIs58. Show Description
gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs58 [hsp-16.2p::mCherry::256xLacO::4xLexA + unc-119(+)]. Small transgene/large array. Superficially wild-type. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have green intestine (from late L4 stage). Might still carry unc-119(ed3) in background. Reference: Rohner S, et al. J Cell Biol. 2013 Mar 4;200(5):589-604. doi: 10.1083/jcb.201207024. PMID: 23460676
|
|
| GW566 |
C. elegans |
gwIs39 III; gwIs4 X. Show Description
gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs4 [baf-1p::GFP-lacI::let-858 3UTR + myo-3p::RFP] X. Superficially wild-type. Expresses GFP-LacI throughout development from early embryogenesis, forming a large spot at the lacO array. Worms have red muscle (from L1 stage) and green intestine (from late L4 stage). Reference: Towbin BD, et al. Cell. 2012 Aug 31;150(5):934-47. PMID: 22939621
|
|
| GW76 |
C. elegans |
gwIs4 X. Show Description
gwIs4 [myo-3p::RFP + baf-1::GFP-lacI:::let-858 3'UTR] X. [NOTE: transgene seems prone to silencing. Pick RFP+ to maintain.] Superficially wild-type. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. RFP expression in muscles. Reference: Meister P, et al. Genes Dev. 2010 Apr 15;24(8):766-82. PMID: 20395364
|
|
| GW829 |
C. elegans |
gwIs39 III; cec-4(ok3124) IV; gwIs4 X. Show Description
gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs4 [baf-1p::GFP-lacI::let-858 3UTR + myo-3p::RFP] X. Superficially wild-type. Expresses GFP-LacI throughout development from early embryogenesis, forming a large spot at the lacO array. Worms have red muscle (from L1 stage) and green intestine (from late L4 stage). Reference: Gonzalez-Sandoval A, et al. Cell. 2015 Dec 3;163(6):1333-47. PMID: 26607792
|
|
| GW833 |
C. elegans |
cec-4(ok3124) IV; gwIs4 X. Show Description
gwIs4 [myo-3p::RFP + baf-1::GFP-lacI:::let-858 3'UTR] X. Superficially wild-type. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have red muscle (from L1 stage). Reference: Gonzalez-Sandoval A, et al. Cell. 2015 Dec 3;163(6):1333-47. doi: 10.1016/j.cell.2015.10.066. PMID: 26607792.
|
|
| GXW1 |
C. elegans |
C. elegans wild isolate. Show Description
Caenorhabditis elegans wild isolate. Isolated from soil under a Kiwi fruit tree in a botanical garden in Wuhan City, Hubei Province, China, on Nov 11, 2010. Lat: 30° 32' 34.40" N; Lon: 114° 25' 11.38" E. This strain was whole-genome sequenced as part of the Million Mutation Project (MMP). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| HA2040 |
C.elegans |
sir-2.4(n5137) I; sir-2.1(ok434) IV; sir-2.2(n5136) X. Show Description
Superficially wild-type. Reference: Anderson E, et al.Mech Ageing Dev. 2016 Mar;154:30-42.
|
|
| HA2619 |
C.elegans |
sod-1(tm776) II; rtSi1 IV. Show Description
rtSi1 [sod-1p::sod-1(WT) + Cbr-unc-119(+)] (inserted into cxTi10882) IV. Superficially wild-type. HA2619 serves as a control strain for HA2464. Reference: Baskoylu SN, et al. PLoS Genet. 2018;14(10):e1007682.
|
|
| HA2823 |
C.elegans |
smn-1(rt248) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); nuIs175 X. Show Description
nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. smn-1 heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP rt248 homozygotes (larval arrest). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. NOTE: myo-2p::RFP is not visible in this strain. rt248 is a 8 bp deletion in smn-1. [rt248: TTTTGATTAGC--------ATCCCAAAC] [wild-type: TTTTGATTAGCTCCGTATCATCCCAAAC] Reference: Dimitriadi M, et al. Proc Natl Acad Sci U S A. 2016 Jul 26;113(30):E4377-86. O'Hern PJ, et al. Elife. 2017 May 2;6. pii: e20752.
|
|
| HA2845 |
C.elegans |
fust-1(rt255) II. Show Description
Superficially wild-type. This is the appropriate control strain for FUS disease models HA2846 and HA2847. This control strain contains presumably silent edits inserted by CRISPR editing while creating the FUS disease models in HA2846 and HA2847, and was back-crossed to remove the pha-1 allele used in strain construction. Reference: Baskoylu S, et al. bioRxiv 799932; doi: https://doi.org/10.1101/799932
|
|
| HA2846 |
C.elegans |
fust-1(rt256[R446S]) II. Show Description
fust-1(rt256[R446S]) was created by CRISPR editing of arginine codon in C. elegans fust-1 to create FUS disease model for human mutation R524S. This strain also contains additional silent edits (also present in control strain HA2845), and was back-crossed to remove the pha-1 allele used in strain construction. Under normal culture conditions HA2846 animals are superficially wild-type; after stress latent defects are observed. Reference: Baskoylu S, et al. bioRxiv 799932; doi: https://doi.org/10.1101/799932
|
|
| HA2847 |
C.elegans |
fust-1(rt257[P447L]) II. Show Description
fust-1(rt257[P447L]) was created by CRISPR editing of proline codon in C. elegans fust-1 to create FUS disease model for human mutation P525L. This strain also contains additional silent edits (also present in control strain HA2845), and was back-crossed to remove the pha-1 allele used in strain construction. Under normal culture conditions HA2847 animals are superficially wild-type; after stress latent defects are observed. Reference: Baskoylu S, et al. bioRxiv 799932; doi: https://doi.org/10.1101/799932
|
|
| HA2986 |
C. elegans |
sod-1(rt448[sod-1WTC]) II. Show Description
Superficially wild-type at 25C. Can be maintained 15-25C. rt448 is wild-type control strain containing all the silent codon changes used during CRISPR/Cas9 genome editing of sod-1. This strain was back-crossed to remove the edited pha-1 allele used in strain construction. Reference: Baskoylu S, et al. PLOS Genetics (https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1007682). NOTE: A micropublication (PMID: 33474528) incorrectly described sod-1 alleles in the text. This strain contains rt448 and is the wild-type control for both G93Ac and G85Rc; rt449 is sod-1[G93Ac] and rt451 is sod-1[G85Rc].
|
|
| HA2987 |
C. elegans |
sod-1(rt449[G93AC]) II; vsIs48. Show Description
vsIs48 [unc-17::GFP]. Superficially wild-type at 25C. Can be maintained 15-25C, and latent defects observed after oxidative stress. GFP expressed in all cholinergic neurons. rt449 was created by CRISPR editing of the cognate glycine codon in C. elegans sod-1 to create a disease model for human mutation SOD1 G93A. This strain contains additional silent edits in sod-1, and was back-crossed to remove the edited pha-1 allele used in strain construction. The appropriate control is HA2986. Reference: Baskoylu S, et al. PLOS Genetics (https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1007682). NOTE: A micropublication (PMID: 33474528) incorrectly described sod-1 alleles in the text. This strain contains rt449, which is sod-1[G93AC], while rt451 is sod-1[G85RC] and rt448 is the wild-type control for both.
|
|
| HA3299 |
C. elegans |
sod-1(rt451[sod-1(G85RC)]) II. Show Description
Superficially wild-type at 25C. Can be maintained 15-25C, and latent defects observed after oxidative stress. rt451 was created by CRISPR editing of the cognate glycine codon in C. elegans sod-1 to create a disease model for human mutation SOD1 G85R. This strain contains additional silent edits in sod-1, and was back-crossed to remove the edited pha-1 allele used in strain construction. The appropriate control is HA2986. Reference: Baskoylu S, et al. PLOS Genetics (https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1007682). NOTE: A micropublication (PMID: 33474528) incorrectly described sod-1 alleles in the text. This strain contains rt451, which is sod-1[G85RC], while rt449 is sod-1[G93AC] and rt448 is the wild-type control for both.
|
|
| HBR1971 |
C. elegans |
nlp-42(syb235) V. Show Description
Complete CRISPR/Cas-9 knock-out (2317bp deletion) of the gene nlp-42(Y80D3A.10). Two times backcrossed with N2. Homozygous. Superficial wild-type.
Primers for crossing:
Fwd: cgagacttttaaccccgtcg
InFwd: aaagcccatgacttgctgaa
Rev: gctcaggtggttagagggtt
Wild-type bands: 580bp, 2652bp. Mutation band: 335bp.
|
|
| HBR546 |
C. elegans |
goeIs102. Show Description
goeIs102 [aptf-1 5'UTR::ChR2::mKate2::aptf-1 3'UTR + unc-119(+)]. Superficially wild-type. This strain carries an optogenetic transgene that can be used to send worms to sleep immediately at any given time point. Reference: Turek M, et al. Curr Biol. 2013 Nov 18;23(22):2215-2223.
|
|
| HC1292 |
C. elegans |
sid-1(qt160) V. Show Description
sid-1(qt160) V. Null allele. Systemic RNAi deficient. This sid-1(qt160) allele is designed as a efficient Cas9 target for reversion to wild-type sid-1 function in co-conversion experiments. Successful reversion re-enables RNAi targeting any gene of choice. 44 nt sid-1 loss of function cassette inserted into exon 2 (Chr V: 5120123..5120124) contains exogenous crRNA site UcrRNA_AW1, stop codons in all three frames, and KpnI site, which also induces a frame shift. sid-1 LOF cassette sequence: ccgccgcactggacaaacttccctaactgactaaggtaccgata. Derived by 6x out-crossing of parental strain HC1185. Reference: Weisman, Fisher, and Hunter 2025. G3. In press.
|
|
| HGA8001 |
C. elegans |
lynEx1. Show Description
lynEx1 [nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Pick animals with red pharynx to maintain. Lifespan is comparable to wild-type. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.
|
|
| HJZ102 |
C. elegans |
rike-1(syb1165) V/nT1[qIs51] (IV;V). Show Description
Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP rike-1(syb1165) homozygotes (early larval lethality). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Cheng X, et al. Autophagy. 2023 Jan;19(1):241-255. doi: 10.1080/15548627.2022.2071381. PMID: 35521960.
|
|
| HK104 |
C. briggsae |
C. briggsae wild isolate. Show Description
C. briggsae wild type strain collected from Okayama, Japan. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| HK105 |
C. briggsae |
C. briggsae wild isolate. Show Description
C. briggsae wild type strain collected in Sendai, Japan. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| HMZ245 |
C. elegans |
ccar-1(sda11) IV. Show Description
Superficially wild-type except for a slightly shorter body length in adults. Crispr/Cas9 was used to create a 13 bp deletion in exon7 of ccar-1a; breakpoints: CTGATTCGGGAG/sda11/ATCGGAAGTTTC. sda11 is an isoform-specific deletion allele. It only affects the function of CCAR-1A and CCAR-1D, but not CCAR-1B and C. In addition, because CCAR-1D is not expressed in embryos,this allele can be used to specifically inactivate CCAR-1A (the full-length isoform that is the most similar to human CCAR1) during embryogenesis. Reference: Fu R, et al. J Cell Sci. 2018 May 10.
|
|
| HP17 |
C. elegans |
sos-1(pd10) V. Show Description
sos-1 gain-of-function allele originally isolated as a suppressor of sem-5(n1619) lethality. pd10 causes a E99K substitution within the N-terminal histone fold domain of SOS-1. Single mutants appear wild-type.
|
|
| HP23 |
C. elegans |
sos-1(pd9) V. Show Description
sos-1(pd9) is a gain-of-function allele causing a C662Y substitution within the Ras exchange motif of SOS-1. Originally isolated as a suppressor of sem-5(n1619) lethality. Single mutants appear wild-type. Reference: Wooller A & Hopper N. (2014) European Worm Meeting. (Anyone using this allele may cite Neil Hopper as a personal communication based on this meeting abstract.)
|
|
| HPT10 |
C. indonesiana |
Caenorhabditis indonesiana wild isolate. Show Description
Caenorhabditis sp. 77 wild isolate. Male-female. Maintain at 20C or warmer. Elegans group. Isofemale line isolated from rotting banana flowers collected in a forest near Batu, East Java, Indonesia, on 28 Apr 2024. GPS -7.803387, 112.516604. Reference: Devi, et al. G3 (Bethesda). 2025 Aug 6;15(8):jkaf134. doi: 10.1093/g3journal/jkaf134. PMID: 40542721.
|
|
| HPT35 |
C. malino |
Caenorhabditis malino wild isolate. Show Description
Caenorhabditis sp. 78 wild isolate. Male-female. Maintain at 20C or warmer. Elegans group. Isofemale line isolated from rotting flowers of Stewartia pseudocamellia collected near Malino, South Sulawesi, Indonesia, on 6 May 2024. GPS -5.242944, 119.868592. Reference: Devi, et al. G3 (Bethesda). 2025 Aug 6;15(8):jkaf134. doi: 10.1093/g3journal/jkaf134. PMID: 40542721.
|
|
| HPT43 |
C. ceno |
Caenorhabditis ceno wild isolate. Show Description
Caenorhabditis sp. 79 wild isolate. Male-female. Maintain at 20C or warmer. Elegans group. Isofemale line isolated from leaf litter collected in a forest near Jeneberang River Lake, Parangloe, South Sulawesi, Indonesia, on 6 May 2024. GPS -5.238297, 119.642281. Reference: Devi, et al. G3 (Bethesda). 2025 Aug 6;15(8):jkaf134. doi: 10.1093/g3journal/jkaf134. PMID: 40542721.
|
|
| HPT5 |
C. ubi |
Caenorhabditis ubi wild isolate. Show Description
Caenorhabditis sp. 81 wild isolate. Male-female. Maintain at 20C or warmer. Elegans group. Isofemale line isolated from rotting Brugmansia flowers collected in a forest near Batu, East Java, Indonesia, on 28 Apr 2024. GPS -7.805005, 112.516905. Reference: Devi, et al. G3 (Bethesda). 2025 Aug 6;15(8):jkaf134. doi: 10.1093/g3journal/jkaf134. PMID: 40542721.
|
|
| HPT50 |
C. brawijaya |
Caenorhabditis brawijaya wild isolate. Show Description
Caenorhabditis sp. 80 wild isolate. Male-female. Maintain at 20C or warmer. Elegans group. Isofemale line isolated from rotting wild Musa pseudostems collected in the forest on the road between Bromo and Malang, East Java, Indonesia, on 11 May 2024. GPS -7.99746, 112.87387. Reference: Devi, et al. G3 (Bethesda). 2025 Aug 6;15(8):jkaf134. doi: 10.1093/g3journal/jkaf134. PMID: 40542721.
|
|
| HR1060 |
C. elegans |
tbb-2(sb26) III. Show Description
Behaves as wild-type.
|
|
| HRN666 |
C. elegans |
wrt-10(aus36) II. Show Description
5-bp deletion. Superficially wild-type. Reference: https://www.micropublication.org/journals/biology/micropub-biology-000169/
|
|
| HRN667 |
C. elegans |
wrt-10(aus37) II. Show Description
2-bp deletion. Superficially wild-type. Reference: https://www.micropublication.org/journals/biology/micropub-biology-000169/
|
|
| HRN680 |
C. elegans |
wrt-6(aus41) X. Show Description
49-bp deletion. Superficially wild-type. Reference: https://www.micropublication.org/journals/biology/micropub-biology-000169/
|
|
| HS1257 |
C. elegans |
unc-76(e911) V; osEx219. Show Description
osEx219 [pbrm-1::GFP + unc-76(+)]. Pick wild-type to maintain. GFP expression in most somatic nuclei. Reference: Shibata Y, et al. Dev Biol. 2012 Jan 15;361(2):349-57.
|
|
| HS1380 |
C. elegans |
unc-76(e911) V; osEx240. Show Description
osEx240 [bet-1p::bet-1::GFP + unc-76(+)]. Pick Wild-type (non-Unc) to maintain. GFP expression in most somatic cells. Reference: Shibata Y, et al. Development. 2010 Apr;137(7):1045-53.
|
|
| HS1749 |
C. elegans |
mig-1(e1787) lin-17(n671) mom-5(ne12) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Segregates WT GFP+ heterozygotes, non-GFP Unc Sys, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Yamamoto et al. PLoS Genet. 2011 Oct;7(10):e1002308.
|
|
| HS1790 |
C. elegans |
mig-1(e1787) lin-17(n671) mom-5(ne12) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); cfz-2(ok1201) V. Show Description
mig-1 confirmed by complementation tests, and cfz-2 by PCR. Segregates WT GFP+ heterozygotes, non-GFP Unc Sys, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Yamamoto et al. PLoS Genet. 2011 Oct;7(10):e1002308.
|
|
| HS2067 |
C. elegans |
mig-1(e1787) lin-17(n671) mom-5(ne12) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); cfz-2(ok1201) wIs51 V; lin-18(e620) X. Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Heterozygotes are GFP+(pharynx) wild-type and segregate GFP+(pharynx) wild-type, GFP-(pharynx) Sys Psa Unc and dead eggs. PIck GFP+(pharynx) wild-type to maintain. Presence of cfz-2 was confirmed by PCR; mig-1 by complementation test. Reference: Yamamoto Y, et al. PLoS Genet. 2011 Oct;7(10):e1002308.
|
|
| HT1686 |
C. elegans |
unc-119(ed3) III; wwEx61. Show Description
wwEx61 [ins-1p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
|
|
| HT1687 |
C. elegans |
unc-119(ed3) III; wwEx62. Show Description
wwEx62 [ins-2p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
|
|
| HT1690 |
C. elegans |
unc-119(ed3) III; wwIs26. Show Description
wwIs26 [ins-3p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
|
|
| HT1693 |
C. elegans |
unc-119(ed3) III; wwEx63. Show Description
wwEx63 [ins-4p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
|
|
| HT1695 |
C. elegans |
unc-119(ed3) III; wwEx64. Show Description
wwEx64 [ins-5p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
|
|
| HT1701 |
C. elegans |
unc-119(ed3) III; wwEx65. Show Description
wwEx65 [ins-6p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
|
|
| HT1702 |
C. elegans |
unc-119(ed3) III; wwEx66. Show Description
wwEx66 [ins-7p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
|
|
| HT1704 |
C. elegans |
unc-119(ed3) III; wwEx67. Show Description
wwEx67 [ins-8p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
|
|