Search Strains

q1015 is a sygl-1::V5 tagged endogenous locus. Superficially wild-type. Reference: Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.

Maintain at 15C. Germline tumor formation at 25C. A mix of fertile wild-type and proximal tumorous animals at 20C. glp-1(ar202) V5 CRISPR/Cas9 gene editing was used to insert a 3xV5 tag into C-terminus of GLP-1 between amino acids K(1209) and S(1210) using the same reagents as described for tagging wild-type GLP-1 (Sorensen et al., 2020). GLP-1 ar202V5 germlines express GLP-1 in membranes.

Slightly smaller germline mitotic region than wild-type. Reference: Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.

Homozygous maternal effect lethal double mutant balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested GFP+ nT1[qIs51] aneuploids, and non-GFP puf-3(q966) puf-11(q971) homozygotes (maternal effect lethal). Homozygous nT1[qIs51] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain.

Heterozygotes are wild-type and segregate wild-type, Unc-36 eT1 homozygotes, UncSteriles, and arrested eT1 aneuploid progeny (dead eggs). Maintain by picking wild-type and check for correct segregation of progeny to maintain. eT1 previously known as unc-36(e873). Do not distribute this strain; other labs should request it from the CGC.

Pick wild-type GFP+ to maintain. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes. fbf-1(q1227) fbf-2(q945[3xFLAG::fbf-2]) homozygotes are partially sterile, ~50% make excess sperm and delay oogenesis resulting in delayed egg laying when compared to wild-type animals. Pick WT dim GFP and check for correct segregation of progeny to maintain. q1227 is an engineered Y477A point mutation in FBF-1 derived by modification of parental strain JK5810.

Pick wild-type GFP+ to maintain. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. q1011 is an engineered Y479A point mutation in the R7/R8 loop of 3xFLAG-tagged FBF-2 derived by modification of parental strain JK5810 fbf-2(q945[3xFLAG::fbf-2]) II. q1228 is an engineered Y477A point mutation in FBF-1 derived by modification of parental strain JK5984.

Pick wild-type GFP+ to maintain. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. q1250 is an engineered Y477A point mutation in FBF-1 derived by modification of parental strain JK3101.

Pick wild-type GFP+ to maintain. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (Mog). Pick WT dim GFP and check for correct segregation of progeny to maintain. q1251 is an engineered H324A point mutation in FBF-1 derived by modification of parental strain JK3101.

Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered (H326A, Y479A) substitutions. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-2 homozygotes (sterile?). Pick WT dim GFP and check for correct segregation of progeny to maintain.

Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered (H453A H454A E457A) substitutions. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (Sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain.

Heterozygotes are wild-type and segregate wild-type heterozygotes, sterile Mog, and Unc Dpy. Pick wild-type and check for proper segregation of progeny. Do not distribute this strain; other labs should request it from the CGC.

Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered (H453A H454A E457A Y479A) substitutions. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (Sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain.

Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered Y479F substitution. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-2 homozygotes (sterile?). Pick WT dim GFP and check for correct segregation of progeny to maintain.

Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered (N415A Y416A Q419A S453A H454A E457A) substitutions. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (Mog). Pick WT dim GFP and check for correct segregation of progeny to maintain.

Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered Y479E substitution. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-2 homozygotes (sterile?). Pick WT dim GFP and check for correct segregation of progeny to maintain.

qSi422 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEa TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. Engineered TGT to ACA substitution in FBEa in rajSi50 gld-1 3’UTR reporter and substitution of downstream G to C to disrupt PAM site. GFP is visible in germline nuclei. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / prHJS401 TGGCAACATGATGTATCGCTGT (~100 bp band in mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."

qSi424 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEb TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. Engineered TGT to ACA substitution in FBEb in rajSi50 gld-1 3’UTR reporter and GFP is visible in germline nuclei. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEb mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / slc302 GGGTTAGCGTTAAGATAACTGT (~500 bp band in FBEb mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."

qSi425 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEa TGT to ACA] [FBEb TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. qSi425 contains engineered TGT to ACA substitution in FBEa in rajSi50 gld-1 3’UTR reporter and substitution of downstream G to C to disrupt PAM site, and TGT to ACA substitution in FBEb in rajSi50 gld-1 3’UTR reporter. GFP is visible in germline nuclei. Derived by targeted modification of FBEb in parental strain JK6690. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / prHJS401 TGGCAACATGATGTATCGCTGT (~100 bp band in FBEa mutant, no product in wild-type). Primers to confirm FBEb mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / slc302 GGGTTAGCGTTAAGATAACTGT (~500 bp band in FBEb mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."

Balanced temperature-sensitive allele of glp-1. Maintain at 20-25C. At restrictive temperature (25C), heterozygotes are wild-type and segregate wild-type, Unc-36 eT1 homozygotes, UncSteriles, and arrested eT1 aneuploid progeny (dead eggs). At permissive temperature (15C), heterozygotes are wild-type and segregate wild-type, Unc-36 eT1 homozygotes, fertile Unc-32 (can be maintained as a homozygous stock at 15C), and arrested eT1 aneuploid progeny (dead eggs). Maintain by picking wild-type and check for correct segregation of progeny to maintain. eT1 previously known as unc-36(e873). Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are wild type and segregate wild type, paralyzed Dpys, and die-1 homozygous embryos.

Pick wild type animals to maintain.

wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Superficially wild-type.

Halicephalobus mephisto wild isolate. Grow at 37C: can survive higher temperatures than C. elegans. Useful model organism for studying heat tolerance; has expanded Hsp70 and AIG1 gene families. Has approximately 1.15% snp heterozygosity. Parthenogenetic reproduction so it cannot be out-crossed. References: Borgonie G, et al. Nature. 2011 Jun 2;474(7349):79-82. Weinstein DJ, et al. Nat Commun. 2019 Nov 21;10(1):5268.

Maintain by picking GFP+ wild-type worms. Heterozygotes segregate wild-type GFP+ heterozygotes, sterile GFP- gck-1 homozygotes, and dead eggs (nT1 homozygotes). Reference: Schouest et al, Plos ONE 4(10):e7450 (2009).

C. elegans wild isolate. Reference: Andersen EC, et al. Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

CRISPR-engineered KO strain of haps-1 made by knock-in of tandem stop codons to the first exon of endogenous haps-1 locus. haps-1(C48B6.3) is the C. elegans ortholog of human HAPSTR1. haps-1(ljt1) is superficially wild-type when cultured at 20C, but is hypersensitive to paraquat (redox stress), MLN4924 (neddylation inhibition), and camptothecin (genotoxic stress). Reference: Amici DR, et al. Proc Natl Acad Sci U S A. 2022 Jul 5;119(27):e2111262119. doi: 10.1073/pnas.2111262119. PMID: 35776542.

Isolated from rotting pears sampled below their tree on 15 Oct 2006 in Le Blanc (Indre, France). Sample plated on 16 Oct 2006. Picked as an adult on 18 Oct 2006. PrA1. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Male-female strain. Isolated by Marie-Anne Felix from decomposing fruit and vegetables sampled on March 11, 2007, in small vegetable gardens in Okazaki (East of Nagoya), Aichi Prefecture, Japan. Isofemale line. Maintain by mating.

Male-female strain. Isolated by Marie-Anne Felix from decomposing fruit and vegetables sampled on March 14, 2007, in small vegetable gardens next to the Kacho-en aviary (ca. 100 m) in Kakegawa, Shizuoka prefecture, Japan. Isofemale line. Maintain by mating.

Isolated by Marie-Anne Felix from leaf litter/bark/soil sampled on March 14, 2007, in the woods behind the parking lot of the Kacho-en aviary in Kakegawa, Shizuoka prefecture, Japan (ca. 100 m from the aviary and 200 m from the vegetable gardens). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Male-female strain. Isolated by Marie-Anne Felix from leaf litter/bark/soil sampled on March 14, 2007, in the woods behind the parking lot of the Kacho-en aviary in Kakegawa, Shizuoka prefecture, Japan (ca. 100 m from the aviary and 200 m from the vegetable gardens). Isofemale line. Maintain by mating.

Male-female strain. Isolated by Marie-Anne Felix from leaf litter/bark/soil sampled on March 18, 2007, in the Botanical Gardens of the University of Tokyo in Tokyo, Japan. Isofemale line. Maintain by mating.

Isolated by Marie-Anne Felix from soil sampled on March 14, 2007, in the Kacho-en aviary in Kakegawa, Shizuoka prefecture, Japan. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from a compost sample collected in April 2007 in Concepcion, Chile, in the Palomares area, 2 km NE of the town. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated from a sample of soil (compost) in a pot with rotting tomatoes collected in April 2007 in Concepcion, Chile, in the Villuco area, 3 km SE of the town. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis sp. 7 Male-female strain. Isolated by Marie-Anne Felix from rotting citrus fruit sampled by M. Herrmann in Begoro, Ghana in June 2007. New male-female species of the elegans group. Does not produce cross-progeny with any of the other previous elegans group species. Isofemale line. Maintain by mating.

Isolated by Tony Page from a compost heap sample recovered on 1 Aug 2007 in SouthWest Scotland 4°36.0' West 55°34.6' North. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis sinica wild isolate. Caenorhabditis sp. 5 Male-female strain. Isolated from a small fruit found in the Garden of Harmony in Suzhou, China, on August 17, 2007.

Caenorhabditis sinica wild isolate. Caenorhabditis sp. 5 Male-female strain. Isolated from a small fruit found in the Feilaifeng Park in Hangzhou, China, on August 25, 2007. Similar fruit as JU1201.

Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis sp. 7 Male-female strain. Caenorhabditis sp. 7 is currently an undescribed species. The sequenced strain, JU1286, is an isogenic inbred line derived from strain JU1199 by 20 consecutive matings of 1 virgin female and 1 male. The inbreeding was done by Marie-Anne Felix. Strain JU1199 was isolated in June 2007 by Matthias Herrmann from a rotting citrus fruit in Begoro, Ghana, Africa. C. sp. 7 is a gonochoristic species with about equal proportions of males and females.

Caenorhabditis sp. 9 Male-female strain. Isolated from rotting flowers and leaves sampled in the Zoo/Botanical Garden of Trivandrum, Kerala, India on 21 Dec 2007. Culture at 20°C or above. Reference: Félix, Braendle & Cutter, 2014

Caenorhabditis sp. 10 Male-female strain. Isolated by Marie-Anne Félix from rotting cacao fruit sampled in Angela Spice Garden a few kilometers from Periyar, Kerala, India on 27 Dec 2007. Culture at 20°C or above.

Hermaphrodite. Isolated by MAF from rotting small red fruits (same as JU1342) and bark in the forest near the top of the mountain in Ponmudi, Kerala, India on 22 Dec 2007 (ca. 20 m from JU1340). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Hermaphrodite. Isolated by MAF from dark brown "fruits" (1x1.5 cm) on fallen tree trunk in the forest near the top of the mountain in Ponmudi, Kerala, India on 22 Dec 2007. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Hermaphrodite. Isolated by MAF from a mix of rotting fruits, leaf litter, soil, bark, flowers, etc. sampled in a ca. 3 km wide area in Periyar Natural Preserve, Kerala, India on 28 Dec 2007. Isolated from a plate containing a rotting fruit similar to that of sample #46 - JU1361/2). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).