Search Strains

More Fields
Strain Species Genotype Add
VC309 C. elegans tag-65(ok535) V/nT1 (IV;V). Show Description
F58G11.5. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous ok535 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3162 C. elegans +/szT1 [lon-2(e678)] I; dnj-14&glit-1(ok237)/szT1 X. Show Description
F55D10.3, K02G10.8. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok237 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGTGTTCGGTAAGCATTGGG. External right primer: AAAGTGTGTTCCGTCCTTGG. Internal left primer: CTGCCGTGGAATCTACCTGT. Internal right primer: GCAGTCGAACAACCACTTCA. Internal WT amplicon: 3216 bp. Deletion size: 2229 bp. Deletion left flank: TTTTGAGAAGGCGGTGGAGGCATGGCAATC. Deletion right flank: TTCGCTAAAAAATTGAGCCAATTTATTATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3188 C. elegans C17G10.2(gk3077)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C17G10.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk3077 homozygotes (embryonic or early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAGAATGCAAAACCTGAGAACAA. External right primer: TACAGCTGGATTTTCAACTGGAT. Internal left primer: ATACACCCGCTTTCCACAAG. Internal right primer: CCTCCAGCTTTCGATTTACG. Internal WT amplicon: 2029 bp. Deletion size: 368 bp. Deletion left flank: TTCGGTTACTCTTTGTTTTATATTTATTTT. Deletion right flank: TATTCAGTCTATGAAATACGATAAAGAAGA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3209 C. elegans Y48G10A.4(gk3088)/hIn1 [unc-101(sy241)] I. Show Description
Y48G10A.4. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and gk3088 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTTAATTGTTCGGCGAATTTT. External right primer: AAACATTTTCAACCCTGCAAGT. Internal left primer: ATACGTCACCCGAGCAATTC. Internal right primer: CAACCAGAATGCAGAGCAAA. Internal WT amplicon: 1226 bp. Deletion size: 763 bp. Deletion left flank: CCAGTATAGATTGAATAACTTTAAAAATTT. Deletion right flank: AAAATGCTCCACGTACGCATTCTCATGATT. Insertion Sequence: AACTATAGTTATTTAAATTCTTACTGTAGTTTTCGCTAAGTGATATCGCGCGTCAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3244 C. elegans C01G12.1(gk3190) II. Show Description
This strain is homozygous for a deletion (gk3190) in C01G12.1, detectable by PCR using the following primers. External left primer: TTTTCCAATTTTCCTGCACC. External right primer: ACCTGTTGAGCCTGCTGAGT. Internal left primer: AAAACAATTCGGCATTCGAC. Internal right primer: TTCATCTGCTGCTTGACCAC. Internal WT amplicon: 1381 bp. Deletion size: 421 bp. Deletion left flank: AAAAATAATTCAACATTTGAAACAAAAAAC. Deletion right flank: TATCGTGGTTGGACCCGTTTTTGAAGGATA. Insertion Sequence: GGATATATGTATATATATATAT. Validation: gk3190 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3472 C. elegans C23G10.8(gk3389) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C23G10.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3389 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCATTGAATCTCCCGTGTCT. External right primer: ATACTCAGTCAACGGCCAGG. Internal left primer: TGCATTCGTTTATCCATCCA. Internal right primer: TGTTTGAACTGCTTTGCCTG. Internal WT amplicon: 1992 bp. Deletion size: 418 bp. Deletion left flank: TCAAGTTTCAGCGAATTAAAAAGCTTCTCA. Deletion right flank: GGCCATCCACTCCATGAACGTTTTATCGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC366 C. elegans tsp-12(ok239) IV. Show Description
T14G10.6 . Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC381 C. elegans atm-1(gk186) I. Show Description
Y48G1BL.2. Superficially wild type. [NOTE: According to WormBase, gk186 is a 548 bp deletion. Left external: gtcgggttttgatgcacttt Right external: atctttccatcgtttccacg Left internal: aaattcgatttttcgcgatg Right internal: caattgacgcaatttgcact] Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC385 C. elegans aex-4&tag-18(ok614) X. Show Description
T14G12.2, T14G12.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3940 C. elegans Y57G11A.5(gk5018[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1099 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAATCAGTTTTTACACTTTTAAATATGTTA; Right flanking sequence: GGGTACTTGGTTGTCAGAGCTATTGCTTTT. See WormBase Variation gk5018 for details.
VC3966 C. elegans Y57G11C.36(gk5042[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1197 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTCCGAAAAGATGGGAATTGGCGATACGGA; Right flanking sequence: tcaggcagaagatgactctgaaattaaaaa. See WormBase Variation gk5042 for details.
VC4031 C. elegans Y57G11C.22(gk5104[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 5973 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACAATTGATTCAAGTTAGCTTGAATCCTGT ; Right flanking sequence: GGTGGAATGTCTCCAATACACGACATACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4117 C. elegans F57G12.1(gk5196) X. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5194 mutation is A->T, flanking sequences CTCTTTGCGTGGTCTCTGACGCTCGGTTGG and TAATCGATGATCACCTGGCGTGTGAAAGGC.
VC4122 C. elegans F53G12.9(gk5202) I. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5202 mutation is G->A, flanking sequences TTTCTTCGGAGCAAGCTAATTCCCTATGAA and TGAGAGCATTTAGGTTAATAAACATAGTCC.
VC4126 C. elegans Y39G10AR.15(gk5206) ZC334.7(gk5207) I; cnnm-5(gk5208) III. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5206 mutation is T->A, flanking sequences GGCCTTTCCAACTTAGAATTTTGGTCGTCC and GAAAAATAACGAAGTTATGGTGAACTCCCT. The gk5207 mutation is C->T, flanking sequences CCTGAGATCAAATGTACAAATTTTCAGGCC and GACGCTACCCGGTAATGATGTACACCCTGA. The gk5208 mutation is T->A, flanking sequences CAATCGTGATGATTCCGACTACTTTCGAGC and GAAATTTGGTGAAACTTTAGGGCTACAATG.
VC4223 C. elegans Y57G11B.2(gk5309[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2052 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AGTTAATCTGAAAAGCAACACTAGAAACCA; Right flanking sequence: GGGTTCAAATCAATTATTTCTGTAATTTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC436 C. elegans coq-3(ok506) IV/nT1 [qIs51] (IV;V). Show Description
Y57G11C.11. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny, and mostly sterile GFP- adults (ok506 homozygotes). nT1[qIs51] homozygotes inviable. Pick GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4614 C. elegans F35G12.7(gk5684[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 527 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAATTCGTAGAATCCACAATCCATCCTCCA. Right flanking sequence: TATGGGTCGCACTTGCGCGTCACGGTGTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4775 C. elegans Y71G10AR.4(gk5843[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 8313 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ATCATCAACAGTATCAGCTGAATTGAGCCG. Right flanking sequence: CGGAGCAACAAAAATTGGGACTTCCCAATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4787 C. elegans Y71G12B.13(gk5855[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 5445 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CACTGCAACAATCGCAATTTTCAGACAATT. Right flanking sequence: CGGAGCCTGTGCAATTCCATGTGGGAAATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4819 C. elegans F16G10.5(gk5887[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 995 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: GAACAAAAAAAATCATAAATTGTGTTGTTT. Right flanking sequence: CAGGATTCGCAACCTGCATCCGAAGATATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4868 C. elegans Y48G1BR.1(gk5936[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 3243 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: TTTGGTCAGTGACTTGATTTCAACATTCAC. Right flanking sequence: AAAATTGCAAAAATTAATTTATGTTTTGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4879 C. elegans M01G12.5(gk5947[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 2428 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: TATTTTTGCGAAAACTCGTTTTTTTTGAAG. Right flanking sequence: CCAAATAATCTGAGGAAACAGACCACCTAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4889 C. elegans T14G10.7(gk5957[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1900 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: GCAATTTCGTAGACCAGTTTACAAATTGGC. Right flanking sequence: CGGATAAAATATGAAAATTTCATTGGAATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4895 C. elegans C23G10.2(gk5963[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 939 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: ACGTCTTCTCTTTTTCGGTTCTTCTTGCCG. Right flanking sequence: ATTTTTTTCTCGATGGAAATAAAATTTATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC557 C. elegans +/szT1 [lon-2(e678)] I; nhr-1(ok662)/szT1 X. Show Description
R09G11.2. Homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT and segregate WT, arrested szT1 aneuploids, Lon-2 males, and ok662 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC622 C. elegans dmd-6(gk287) IV. Show Description
F13G11.1a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC632 C. elegans gna-2(ok867) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T23G11.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok867 homozygotes (sterile adult, lays unfertilized eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC729 C. elegans gna-2(gk308) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T23G11.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk308 homozygotes (sterile, lays eggs that don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC754 C. elegans ctl-2(ok1137) II. Show Description
Y54G11A.5a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC810 C. elegans +/szT1 [lon-2(e678)] I; gakh-1(ok1284)/szT1 X. Show Description
F46G11.3/tag-257. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, arrested szT1 aneuploids, Lon-2 males (szT1 hemizygotes), and ok1284 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC812 C. elegans ifbp-1(ok1339) V. Show Description
M04G12.1a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC849 C. elegans lin-7(ok1094)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
Y54G11A.10. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpy mT1 homozygotes, and ok1094 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC866 C. elegans tub-2(gk417) I. Show Description
Y71G12A.3. Superficially wild type. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC883 C. elegans tag-273(gk371) IV. Show Description
Y57G11A.1a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC927 C. elegans pnk-1(ok1435) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C10G11.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1435 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VK1870 C. elegans vkEx1870. Show Description
vkEx1870 [nhx-2p::F13D12.6(G166R)::YFP + myo-2p::mCherry]. YFP+ intestine. mCherry+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
VT3805 C. elegans maIs105 V; alg-1(ma443) X. Show Description
Maintain at 20C. maIs105 [col-19::GFP] V. ma443 is a G199S substitution mimicking human AGO1 G199S mutation. Adult ma443 mutants exhibit reduced or absent COL-19::GFP expression in Hyp7 cells. Defective vulval development and adult lethality are more penetrant at restrictive temperature (25C). Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125.
VT3809 C. elegans alg-1(ma443) X. Show Description
Maintain at 20C. ma443 is a G199S substitution mimicking human AGO1 G199S mutation. Adult ma443 mutants exhibit reduced or absent COL-19::GFP expression in Hyp7 cells. Defective vulval development and adult lethality are more penetrant at restrictive temperature (25C). Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125.
WIN179 C. elegans wago-4(jog179[PH::3xFlag::GFP::wago-4 *gg620]) II. Show Description
Temperature sensitive: maintenance at 15-20C. Reduced number of progeny at elevated temperatures. PH domain added to the 3xFLAG::GFP-tagged endogenous wago-4 locus in parental strain YY1325. This allele localizes WAGO-4 to the plasma membrane, but de-localization is not complete (some residual germ granule signal is detected).
WIN180 C. elegans wago-4(jog180[mts::3xFlag::GFP::wago-4 *gg620]) II. Show Description
Temperature sensitive: maintain at 15-20C. Reduced number of progeny and mortal germline phenotype at elevated temperatures. Mitochondria Targeting Sequence (mts) added to the 3xFLAG::GFP-tagged endogenous wago-4 locus localizes tagged WAGO-4 to mitochondria. This allele was introduced into 3xFlag::GFP tagged endogenous wago-4 locus in parental strain YY1325.
WIN253 C. elegans glh-4(jog16) glh-2(jog49) glh-1(jog50) I. Show Description
Temperature sensitive: maintain at 15-20C. Reduced number of progeny and mortal germline phenotype at elevated temperatures. Engineered mutations of FG repeats in three Vasa like GLH proteins (GLH-1, GLH-2 and GLH-4). glh-1(jog50) is F to A substitution. glh-4(jog16) is F to A substitution. glh-2(jog49) is a deletion of the FG repeats. This strain exhibits a subtle change in germ granule composition while maintaining their architecture. WAGO-4 is mislocalized to the cytoplasm leading to compromised function.
WJA1004 C. elegans unc-54(srf1004[unc-54::T2A::FLAG::rareArg12::GFP]) I. Show Description
Unc. Reporter for no-go mRNA decay. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369.
WJA1097 C. elegans rps-10(srf0825[K125R]) rps-20(srf1046[K6R+K9R]) unc-54(srf1004[unc-54::T2A::FLAG::rareArg12::GFP]) I. Show Description
Nuclear body wall muscle GFP+.
XY1054 C. elegans cep-1(lg12501) I. Show Description
1213 bp deletion corresponding to bp 30458-31670 on cosmid F52B5. Takes out a large part of the cep-1 open reading frame.
YG1007 C. elegans baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); syIs50. Show Description
syIs50 [cdh-3::GFP + dpy-20(+)]. Heterozygotes are WT and GFP+, and segregate arrested hT2 aneuploids, non-GFP gk324 homozygotes (Sterile and Unc). All worms express cdh-3::GFP at the anchor cell. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.
YG1011 C. elegans baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); qIs19 V. Show Description
qIs19 [lag-2p::GFP::unc-54 3'UTR + rol-6(su1006)] V. Heterozygotes are Rollers with pharyngeal GFP signal, and segregate arrested hT2 aneuploids, and non-GFP gk324 homozygotes (Sterile and Unc). All worms express lag-2p::GFP at the distal tip cells. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.
YG1017 C. elegans baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); syIs78. Show Description
syIs78 [ajm-1::GFP + unc-119(+)] is probably on LG I (not on II, III, V or X). Heterozygotes are WT and GFP+, and segregate arrested hT2 aneuploids, non-GFP gk324 homozygotes (Sterile, Roller and Unc). All worms express ajm-1::GFP (Junction Associated Protein). qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.
YG1021 C. elegans baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); ccIs4810 X. Show Description
ccIs4810 [(pJKL380.4) lmn-1p::lmn-1::GFP::lmn-1 3'utr + (pMH86) dpy-20(+)] X. Heterozygotes are WT with pharyngeal GFP signal, and segregate arrested hT2 aneuploids, non-GFP gk324 homozygotes (Sterile and Unc). All worms express Cel-lamin::GFP (lmn-1 gene is expressed at the nuclear periphery). qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.
YG1036 C. elegans baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); zzIs16. Show Description
zzIs16 [(pJE3) eff-1::GFP + rol-6(su1006)]. Heterozygotes are Rollers with pharyngeal GFP signal, and segregate arrested hT2 aneuploids, and non-GFP gk324 homozygotes (Sterile, Roller and Unc). All worms express GFP driven by eff-1 promoter. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.