Search Strains

C17G10.4 Homozygous. Outer Left Sequence: cagtcgtggatgaacactcg. Outer Right Sequence: caccacaaatgactgttccg. Inner Left Sequence: gagacacttttctcggacgg. Inner Right Sequence: tgaatcgaaatcgtgaacca. Inner Primer PCR Length: 3306. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K04G11.4 Homozygous. Outer Left Sequence: aaccctccacttttgtcacg. Outer Right Sequence: gttaagggcagcaaccaaaa. Inner Left Sequence: tctggcagtgtgcaaatgat. Inner Right Sequence: ggggccttgagaccttatgt. Inner Primer PCR Length: 2137. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F08G12.4, F08G12.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02G10.3. Homozygous. Outer Left Sequence: TCGTGTGCTTGTTCACATCA. Outer Right Sequence: AGGTTCAACAACAGCGTTCC. Inner Left Sequence: CGCTCTTTCAAAACTGGCTC. Inner Right Sequence: CGTCGTGATTGCGTAAAGAA. Inner Primer PCR Length: 3123 bp. Deletion Size: 1139 bp. Deletion left flank: ACAAAATGTCATTATTATGAATAAATTGCC. Deletion right flank: AGAATTATCCAAATCGGTCAACTTCTCTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y71G12B.11 Homozygous. Outer Left Sequence: tgaagtggtggctcttgttg. Outer Right Sequence: aagttccgtttgttggttgc. Inner Left Sequence: tggtttctaaggggttgcag. Inner Right Sequence: gcgcttctctcaatttgtcc. Inner Primer PCR Length: 3151. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y39G10AR.3 Homozygous. Outer Left Sequence: aaaaaggtaaccgaggtggc. Outer Right Sequence: tcataggctggaggtggttc. Inner Left Sequence: agtcgtcgatttctcggttg. Inner Right Sequence: atttgattgcggtgaccttc. Inner Primer PCR Length: 3341. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F19G12.3 Homozygous. Outer Left Sequence: ccgagctccttcaaagtcac. Outer Right Sequence: gcctgcaactgcactaatca. Inner Left Sequence: gctcattttcataacgggga. Inner Right Sequence: agtgtaccctgcattttggc. Inner Primer PCR Length: 2138. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K11G12.4. Homozygous. Outer Left Sequence: TCGTGGTGTCAAAATAGCCA. Outer Right Sequence: GTGAAGATTGCCGGAAGAAC. Inner Left Sequence: TCAGTTTGGCACCACGTTAG. Inner Right Sequence: CGACAATCACCCACTGTTTG. Inner Primer PCR Length: 3158 bp. Deletion Size: 959 bp. Deletion left flank: ATTTTCAGATTGTAGGCGGATATCATTGTC. Deletion right flank: GACTCAAGTGTGAAATATTTGTTGGCCTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02G10.6 Homozygous. Outer Left Sequence: acgcagtttccaagcatttc. Outer Right Sequence: tccttttcctcctcggtttt. Inner Left Sequence: gggggagtgatggaagaaat. Inner Right Sequence: ttgcaaaccaattgcaagaa. Inner Primer PCR Length: 3075. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F53G12.3. Homozygous. Outer Left Sequence: GAATGCTGGAAGGAGGTGAA. Outer Right Sequence: ATGGGAATGGTGACCCTGTA. Inner Left Sequence: AAACACCCGTTGGTGATGAT. Inner Right Sequence: GTCCATGGTCCAACTGCTTT. Inner Primer PCR Length: 3310 bp. Deletion Size: 1066 bp. Deletion left flank: AACAAGGTACTCCGAAAGGATCTCGCAGAA. Deletion right flank: TGCCAAAGTTCACTAGAAGAGCATATCACG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F58E6.1. Homozygous. [NOTE (N. Pujol - 12/02/13): This strain reportedly contains an unidentified lethal mutation in the background. See IG1241 for a strain that has been outcrossed to remove this background mutation.] Outer Left Sequence: GCAAAACGAGTTTCTCGACC. Outer Right Sequence: TTGTGATTCCTGACCCCTTC. Inner Left Sequence: CTCTTCTGCATTCTCCCCAG. Inner Right Sequence: GCCAAATGATGTCTCCGATT. Inner Primer PCR Length: 3148 bp. Deletion Size: 864 bp. Deletion left flank: ATTGTTAAATGTGGTGAAGCAGAGAATCAT. Deletion right flank: GAAATGAAATTTCAAGCAATCATAGAAACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K11G12.2. Homozygous. Outer Left Sequence: GGGTCCGTCCTTTAGACCAT. Outer Right Sequence: TGTTGTTGCTGGAGCAATTC. Inner Left Sequence: CCCTGCATATGTGTGAAACG. Inner Right Sequence: CGCTTTTCCAGTTTTTGACC. Inner Primer PCR Length: 3281 bp. Deletion Size: 2857 bp. Deletion left flank: AAAGAAGTGAAGCGGCTCTACCACCCCGAC. Deletion right flank: AGAAATCATGTTTGGAAAACAAAAATATTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F55G11.5. Homozygous. Outer Left Sequence: GGTCGAGCTCACACTTCTCC. Outer Right Sequence: AGCTGGTAAAAGCACTCCCA. Inner Left Sequence: GCTTTCCTGCGTCTTTTGAG. Inner Right Sequence: AAGGCAAGGCTGTATTCACG. Inner Primer PCR Length: 2425 bp. Deletion Size: 1426 bp. Deletion left flank: ATGGATCGGGATACATATTTTCAGACAATT. Deletion right flank: TGTGGTCAGTAGTGGAAAAGCTGATTTCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F46G10.6. Homozygous. Outer Left Sequence: CAGATTTGGCAAACCCACTT. Outer Right Sequence: TACAGTCCCCTAGGCCACAC. Inner Left Sequence: TTTCTCTTGCTGGGCAATTT. Inner Right Sequence: CTAAGTCAAGGCAGCCAAGG. Inner Primer PCR Length: 2270 bp. Deletion Size: 955 bp. Deletion left flank: CAAATCAGTGAGTAAAAAAAACTGAAATAA. Deletion right flank: CTTACATCGGAAGAATCCGAGTGATGGCGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T25G12. Homozygous. Outer Left Sequence: GAGATAGGCAATCCCGAACA. Outer Right Sequence: GTCGACGTGTCATTTTGTGG. Inner Left Sequence: AGTGCGATGTGACGAGTCTG. Inner Right Sequence: CAAGCTAGATGTGATGGCGA. Inner Primer PCR Length: 2152 bp. Deletion Size: 871 bp. Deletion left flank: TTACATTTCCATTCTTTCAGACTAACTAAAGCGTA. Deletion right flank: AAAATTTTTTAAAGGTTTGCAACTCTTATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y57G11C.20. Homozygous. Outer Left Sequence: ATACTCGAGCAGACTGGCGT. Outer Right Sequence: ATAATGTCACCAAGCCCAGC. Inner Left Sequence: AACCGTTTTACCCTGCACAC. Inner Right Sequence: AATCAACCCGGAAGACACTG. Inner Primer PCR Length: 2825 bp. Deletion Size: 1017 bp. Deletion left flank: TTCAGACTGATAAAGACGAACAGCGTGAGA. Deletion right flank: TTGATTTTTTAGATTCAAACATTTTATTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K12G11.1. Homozygous. Outer Left Sequence: CGGATAAACCATGCAAGACA. Outer Right Sequence: CATCACGCATTGTTGGGTAG. Inner Left Sequence: CCCCAATTTCTTAAGGCACA. Inner Right Sequence: TACCAGCTTAAAGCGGCAAT. Inner Primer PCR Length: 2943 bp. Deletion Size: 2119 bp. Deletion left flank: AACTTCCAGGCATGCCAGTTTAGGTATGTA. Deletion right flank: AACACTCATTCTCCTGATATTTTATCTCGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y54G11A.13. Homozygous. Outer Left Sequence: CGGCGATTCTTATACTCCCA. Outer Right Sequence: CTTCCCCACATGGTCAATCT. Inner Left Sequence: GGCCAATTTTCTGCCTGATA. Inner Right Sequence: CAACTGCTTTCGCATGGTTA. Inner Primer PCR Length: 2912 bp. Deletion Size: 1420 bp. Deletion left flank: CATTTCCGAAATCCGGATGAACTTTCGTGAACTCTTTGACCATTCCATTTTGAATTTCC TCCAAACAGCCACCCAAATCACTAGCCAAATTCCCAACGAGCCGATCTCTCTCCTCCTC CTTGAGCACTTTCTCCCAGAACTGACGTGGCTGCTCGTAGTTGTGATCGTCTCCAGT. Deletion right flank:  ATGGATTGAACTCCCATTTCTCAGCTTGTTCGAATGTCATCACTTGAATGAACATCTTC CATTCCGGGAAATTTCTTGACTCAATGGCATTGAACAGGTCGCGGATCGCATAGTCTGG ATCCGAAGAGGCGAGCTTTCCAGCGTCAGTTGGATCGAGATTCTTGGAACCTTGAGCAG GCTGAAAAATAGAAAATGAAAATTTAATTCTAGTCCCCGTCTCTCTTAGGCTTACCTTG . Insertion Sequence: GGATTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K11G12.7. Homozygous. Outer Left Sequence: CGATTTAAGCAAGACGGAGC. Outer Right Sequence: ACAGGCCAAAGTCTCGAAAA. Inner Left Sequence: GGACCCTCCAGTCTGTTTTG. Inner Right Sequence: CGCGGATAAAAGTATTCCGA. Inner Primer PCR Length: 3245 bp. Deletion Size: 2190 bp. Deletion left flank: ACGAAACATTTTTTGGTCCATTTTGTTTAT. Deletion right flank: GTGGTGATTGATCGATTACTTCTCTATCTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F08G12.8 Homozygous. Outer Left Sequence: gttgaacacacgcacattcc. Outer Right Sequence: ccatctgctcgttgtaagca. Inner Left Sequence: acagtgaagcgtaaccaccc. Inner Right Sequence: gtatcccatcgggaaatgtg. Inner Primer PCR Length: 2607. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W05G11.6. Homozygous. Outer Left Sequence: CCATGAGCAAAAACCCTCAT. Outer Right Sequence: CGTTCTCTGCGTAACATGGA. Inner Left Sequence: TCGTCAACATCTTCAACCCA. Inner Right Sequence: GGAGACTTCGCTTCGTTGTC. Inner Primer PCR Length: 3069 bp. Deletion Size: 1276 bp. Deletion left flank: AATTTTCTAGTAATTTTCAAGTAAAAGCCT. Deletion right flank: AAGGTCTACTGAGGTTTTTCCTTGAAATTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y39G10AR.18. Homozygous. Outer Left Sequence: ATTTTGCATGAAAACTCCGC. Outer Right Sequence: CTCCTTCTGTGCGTGTGTGT. Inner Left Sequence: GAAAATTGAAAATTCCGCCA. Inner Right Sequence: GCATCCACCACCTTTGTTCT. Inner Primer PCR Length: 2518 bp. Deletion Size: 1462 bp. Deletion left flank: GTCGATTTGCCGGAATGTTTCAATTCCGGC. Deletion right flank: TTTTTTTAGTGGGCACAATTGAAAAAACGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y71G12B.4. Homozygous. Outer Left Sequence: TCCCCGTAGCCATTTAGTTG. Outer Right Sequence: GATGGCGCAGAAATCAAAAT. Inner Left Sequence: GATCTCCAGATTGCTAGCGG. Inner Right Sequence: CTCATTCGGGACACACACAC. Inner Primer PCR Length: 3008 bp. Deletion Size: 976 bp. Deletion left flank: TGGGATTGTGGAGAAATGAATAAGCCGGAT. Deletion right flank: TTGTCCGTGTAGAGTACACGACTTTCCCAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T08G11.1. Homozygous. Outer Left Sequence: CATGTTCCACAGTGCCAAAC. Outer Right Sequence: CAAAATCTCAATGCCCGAAT. Inner Left Sequence: TGACCCTCTTTTCAGCTCGT. Inner Right Sequence: AATCTCCATTCTTTGCCACG. Inner Primer PCR Length: 3284 bp. Deletion Size: 2292 bp. Deletion left flank: TCTCATTTTCCACAGGCTCAATAATGGGCT. Deletion right flank: TATTCAAAACTTCATAAAGAACATACATTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C10G11.6. Homozygous. Outer Left Sequence: GACGAAGACGACGAAGAAGG. Outer Right Sequence: GGGGTACCCGATGAGCTACT. Inner Left Sequence: TTTACCACGGAAAACCTTCG. Inner Right Sequence: TTTTGGTGATTCATCGGGTT. Inner Primer PCR Length: 3386 bp. Deletion Size: 1357 bp. Deletion left flank: TTCCGTCTCCGTTTGTTCGAAAAATTCCCG. Deletion right flank: TTCCTCCGCCAGGACTCGTTGGAATCAATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F55G11.2. Homozygous. Outer Left Sequence: ATGGCATTTGTTAAGCCCTG. Outer Right Sequence: TAGCTTGTCGTTGTCGTTGC. Inner Left Sequence: TTTGTGTTGTTTGGCTCGTC. Inner Right Sequence: CTTGCGGTCCAAAAGACATT. Inner Primer PCR Length: 2122 bp. Deletion Size: 1155 bp. Deletion left flank: ACTAGCTTCCAAGTTGACTATATTAATATT. Deletion right flank: ACTGTAATTCACAAATTTTAGATAAGTTAA. Insertion Sequence: TTGACTATATTAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F22G12.5. Homozygous. Outer Left Sequence: GAAAAGGGGTTAGGAGCAGG. Outer Right Sequence: CCCCTAGATCTGACACTGCC. Inner Left Sequence: TCAAATCGGCTAATTTTCGG. Inner Right Sequence: TCGTCTGCATCTGTGTGTCA. Inner Primer PCR Length: 3163 bp. Deletion Size: 1478 bp. Deletion left flank: TAGAGATTTGCCACGGAGATTCTTCGAGCT. Deletion right flank: ACAGCATCCTGTCTAGATCTAGGCTTAACC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C30G12.6. Homozygous. Outer Left Sequence: TTCATGGGAACACACTCCAA. Outer Right Sequence: CAGGGATCTCACTAGCCCAA. Inner Left Sequence: AACACGTGACGAATGATCCA. Inner Right Sequence: AAACCGTTTTCGCACAAATC. Inner Primer PCR Length: 3210 bp. Deletion Size: 1408 bp. Deletion left flank: TCATTCTTATTCCCTAAAAGAGCTGGAATG. Deletion right flank: TCACAGTTACTTCATCACAACATGTGGTTT. Insertion Sequence: TGTTACTTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F01G12.2 Homozygous. Outer Left Sequence: ggagctggagtggaaatgaa. Outer Right Sequence: ccgcctgctcatctatcttc. Inner Left Sequence: cgcaacggaatatccttttt. Inner Right Sequence: tcgctacccttgatattcgc. Inner Primer PCR Length: 1284. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W03G11.2 Homozygous. Outer Left Sequence: aacccaagatggatgcaaaa. Outer Right Sequence: tctgtggagcatcaggatca. Inner Left Sequence: tcttcatcgggtatgtgcttt. Inner Right Sequence: atcccagtggttttgacgtg. Inner Primer PCR Length: 3140. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48G1C.10. Homozygous. Outer Left Sequence: TCGCTACGCGATACTTTGTG. Outer Right Sequence: AACCCGGTGATTTAATGCAG. Inner Left Sequence: TTGTGCATTACGCATTTTCAG. Inner Right Sequence: TAAAGTTCTGGCGGAGGAAA. Inner Primer PCR Length: 1187 bp. Deletion Size: 575 bp. Deletion left flank: GAGAATCGGATAAAAATAATTTATTTAAGT. Deletion right flank: CCGAATAACGAGAAGCCGCATGTTATAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W05G11.4. Homozygous. Outer Left Sequence: AAGTTGGCTTCCTCTCACCA. Outer Right Sequence: TGAGTAAAAATTTTCGGCGG. Inner Left Sequence: TTATATTCTGCGCAATCATCG. Inner Right Sequence: TGGAAAATATTTGGCTGGAAA. Inner Primer PCR Length: 3073 bp. Deletion Size: 1767 bp. Deletion left flank: CTCGTAAGAGGTGACATTGGAACACTTTCA. Deletion right flank: AGAAATCATCAACAATTATTACTTCCCATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y57G11C.43, Y57G11C.44. Homozygous. Outer Left Sequence: CAAACTCTTCAACACGCCAA. Outer Right Sequence: CAGGAAATTGGAAATCGCAT. Inner Left Sequence: GGGAAACAAAAAGCGGAAAT. Inner Right Sequence: CGTCGTTTCTTCAACACGAA. Inner Primer PCR Length: 2809 bp. Deletion Size: 2090 bp. Deletion left flank: GGTTCATTACCGTGAATTACTTTTTTTAGA. Deletion right flank: TCTTTTATTCTAACAAACACTGGCTTCAAG. Insertion Sequence: AGAAAAATTTACAAAACACTGAGCTTGTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57G12.2 Homozygous. Outer Left Sequence: gctgccattttcagatggtt. Outer Right Sequence: ccccaattgttttcgatcat. Inner Left Sequence: cacatgattcaaggcactcg. Inner Right Sequence: cacatgattcaaggcactcg. Inner Primer PCR Length: 1274. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K12G11.3 Homozygous. Outer Left Sequence: aatggaccacttgaagtccg. Outer Right Sequence: atcaacgaatgaaagacggg. Inner Left Sequence: cagtcccatctccagctgat. Inner Right Sequence: cgatttttcaatgcgatgag. Inner Primer PCR Length: 1362. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02G10.7. Homozygous. Outer Left Sequence: AAGCAGAAAAGGAGCGTGAA. Outer Right Sequence: TCAGGGCCTACCGTAACATC. Inner Left Sequence: ATGTTTTAGAGGGCGGTTGC. Inner Right Sequence: GCCCATTCTGAAGTTTCGAC. Inner Primer PCR Length: 1177 bp. Deletion Size: 436 bp. Deletion left flank: TAACTATGTATAAACATGGATCAGAAGTTG. Deletion right flank: ATTCCCCAGGCAATATGGCAAGACGTTGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F01G12.6 Homozygous. Outer Left Sequence: ttgggacgagaaaatgaagg. Outer Right Sequence: ccaagttgagggtctcggta. Inner Left Sequence: ttgtgcatgggagaagttga. Inner Right Sequence: tgcaacattcataaaaatgcaa. Inner Primer PCR Length: 1279. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y71G12A.3. Homozygous. Outer Left Sequence: AGGCGACTTCTCTCCCTCTC. Outer Right Sequence: TCATCATTATCGCCGATTCA. Inner Left Sequence: GTGTGTGTGTGTGTGTGCGT. Inner Right Sequence: TCCTTTCCACCAACGGATTA. Inner Primer PCR Length: 1267 bp. Deletion Size: 522 bp. Deletion left flank: GGTGTTAGGCTTTTCCACTGGAACTATTCA. Deletion right flank: TAAGCTGCCGATTCCACTCAAGGAGATGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W09G10.4. Homozygous. Outer Left Sequence: CGGAAAATCGAAAAATGTCC. Outer Right Sequence: AAATCACCAATTTTCGCCAC. Inner Left Sequence: TCTCAATCTCCTGTTCCCTCA. Inner Right Sequence: ATTTTCCCCCAATTTTCCAG. Inner Primer PCR Length: 1120 bp. Deletion Size: 457 bp. Deletion left flank: GCTTTGAGCATTGATTCGAGCACACCTTGT. Deletion right flank: ACGGTTACATCTTGGATCTGGAAAATTGGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11G11.1. Homozygous. Outer Left Sequence: CGAATCATCATGAAAAGGCA. Outer Right Sequence: CATTTCCCACGCTTGAGTCT. Inner Left Sequence: GCGCAGTGGGAAGAGTAAAT. Inner Right Sequence: CCTTCTGCCGCAATTTTACA. Inner Primer PCR Length: 1208 bp. Deletion Size: 482 bp. Deletion left flank: TCAGATGTTTTTTTAGTTGTCATTGGCTTC. Deletion right flank: TGATCCAGCTCTTCTCGAAGAATTCCCACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 [NOTE: (06/03/2021) A user reported the original stock of RB2288 received by the CGC was heterozygous. A homozygous line was isolated and verified by PCR.]

T16G12.1 Homozygous. Outer Left Sequence: caacccaacttttgccaact. Outer Right Sequence: tgcttatttggatgccatga. Inner Left Sequence: ctttttgggctcagacttcg. Inner Right Sequence: ggacaactctcgactttgatga. Inner Primer PCR Length: 1326. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C10G11.4 Homozygous. Outer Left Sequence: caatgtccttcccaacatca. Outer Right Sequence: ttaatttttgaattcgcccg. Inner Left Sequence: caagattattatgctacaaactacacg. Inner Right Sequence: gttccagcatctctcctcgt. Inner Primer PCR Length: 1357. Deletion size: about 500bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T23G11.7 Homozygous. Outer Left Sequence: aatgtctgcgaatctcccac. Outer Right Sequence: aaaagcatacggacactggg. Inner Left Sequence: atctcattttccccgctttt. Inner Right Sequence: aaaaggattgatggaataaatcaga. Inner Primer PCR Length: 1184. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01G10.8 Homozygous. Outer Left Sequence: attctgaatgtccggtttgg. Outer Right Sequence: attggtgggtctcgattgaa. Inner Left Sequence: atccagcatttgatgtcacg. Inner Right Sequence: catagctttgagctgaataagtatgtt. Inner Primer PCR Length: 1334. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C17G10.5 Homozygous. Outer Left Sequence: ctccacgagttccaccaaat. Outer Right Sequence: tcaaaatggaaaagggaacg. Inner Left Sequence: cagcttcagtgcctcaaaca. Inner Right Sequence: aaattagagccaagctcgca. Inner Primer PCR Length: 1326. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F08G12.2 Homozygous. Outer Left Sequence: ccacacgagagcactgaaaa. Outer Right Sequence: caccgcattgcatttacaac. Inner Left Sequence: tgataggttcctttgggtgg. Inner Right Sequence: tccagtggaacccaacattt. Inner Primer PCR Length: 1253. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M01G12.14 Homozygous. Outer Left Sequence: aaccgattcctcatccctct. Outer Right Sequence: aggggtcacacacagacaca. Inner Left Sequence: ccacctggatctttcaccat. Inner Right Sequence: ttgattgaacgctgtgaagg. Inner Primer PCR Length: 1305. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F01G10.1 Homozygous. Outer Left Sequence: gtggacatcccacgtcttct. Outer Right Sequence: ttgctcctgggatagtacgg. Inner Left Sequence: aagtacgatgtcgcagagcc. Inner Right Sequence: caattgagactccgacgtga. Inner Primer PCR Length: 1147. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F01G10.8 Homozygous. Outer Left Sequence:ccaaccgacttccttgttgt . Outer Right Sequence: attcgttcatcagccacctc. Inner Left Sequence: ggctgcggggaattatatgt. Inner Right Sequence: tccgagagccaatgttttct. Inner Primer PCR Length: 1192. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F35G12.3A. Homozygous. Outer Left Sequence: CACTGAGCAATTGCCTTTCA. Outer Right Sequence: ATCGCCGAAGGTAGGTTTTT. Inner Left Sequence: CAAACACATCATCCACCACC. Inner Right Sequence: TTTCTTCCAGGTGGATTTGC. Inner primer WT PCR product: 3269. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807