More Fields
Strain Species Genotype
VC381 C. elegans atm-1(gk186) I. Show Description
Y48G1BL.2. Superficially wild type. [NOTE: According to WormBase, gk186 is a 548 bp deletion. Left external: gtcgggttttgatgcacttt Right external: atctttccatcgtttccacg Left internal: aaattcgatttttcgcgatg Right internal: caattgacgcaatttgcact] Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807