Y48G10A.4. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and gk3088 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTTAATTGTTCGGCGAATTTT. External right primer: AAACATTTTCAACCCTGCAAGT. Internal left primer: ATACGTCACCCGAGCAATTC. Internal right primer: CAACCAGAATGCAGAGCAAA. Internal WT amplicon: 1226 bp. Deletion size: 763 bp. Deletion left flank: CCAGTATAGATTGAATAACTTTAAAAATTT. Deletion right flank: AAAATGCTCCACGTACGCATTCTCATGATT. Insertion Sequence: AACTATAGTTATTTAAATTCTTACTGTAGTTTTCGCTAAGTGATATCGCGCGTCAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807