| CB6921 |
C. elegans |
bus-10 & ZK596.4 & ZK596.5 & ZK596.1(e2737) IV. Show Description
Viable, Bus (M. nematophilum resistant), resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1. e2737 is a ~4.5 kb deficiency which removes all of the bus-10 exons, internal ncRNA genes ZK596.4 & ZK596.5, and ZK596.1. Reference: O'Rourke et al (in preparation).
|
|
| CB6931 |
C. elegans |
bus-10 & ZK596.4 & ZK596.5(e2715) IV; dhs-29(e3014) X. Show Description
Bus, bleach-sensitive, resistant to Leucobacter Verde2 and Leucobacter Verde1. e2715 is a small deficiency (3191 bp) which removes all of the bus-10 exons and internal ncRNA genes ZK596.4 & ZK596.5. Reference: O'Rourke et al (in preparation).
|
|
| CB6978 |
C. elegans |
bus-24(e3020) IV. Show Description
Skiddy, bleach-sensitive, Bus (resistant to infection by M. nematophilum), resistant to Leucobacter Verde2 and to Leucobacter Verde1. Missense mutation in Y11D7A.9. Reference: O'Rourke et al (in preparation).
|
|
| CB7007 |
C. elegans |
ilys-3(ok3222) IV. Show Description
Viable, but defective in bacterial grinding and hypersensitive to bacterial pathogens. Derived by out-crossing parental strain VC2496. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.
|
|
| CB7109 |
C. elegans |
acs-20(e3031) IV; him-5(e1490) V. Show Description
Him. Skiddy, bleach-sensitive hermaphrodites and males. Resistant to Leucobacter Verde1. Reference: O'Rourke et al. (in preparation).
|
|
| CB7151 |
C. elegans |
him-8(e1489) IV; ptr-15(e2710) V. Show Description
Him. Bus (resistant to M. nematophilum); hypersensitive to Leucobacter Verde1. References: Gravato-Nobre et al. (2005) PMID: 16079230. Hodgkin et al (in preparation).
|
|
| CB7172 |
C. elegans |
ilys-3(ok3222) IV; lys-7(oj1385) V. Show Description
Viable, poor bacterial grinding, increased sensitivity to bacterial pathogens. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.
|
|
| CB7173 |
C. elegans |
ilys-3(ok3222) IV; ilys-5(tm3151) X. Show Description
Viable, but with poor bacterial grinding and increased susceptibility to some bacterial pathogens. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.
|
|
| CB7198 |
C. elegans |
acs-20(e3031) IV. Show Description
Bleach-sensitive, drug-sensitive, resistant to Leucobacter Verde1. Reference: O'Rourke et al (in preparation).
|
|
| CB7201 |
C. elegans |
bah-2(gk487599) IV. Show Description
Bah (resistant to bacterial Biofilm formation by Yersinia). Reference: O'Rourke et al (in preparation).
|
|
| CB7248 |
C.elegans |
dpy-18(e499)/subs-4(e3026) III; wIs78 IV. Show Description
wIs78 [SCMp::GFP + ajm-1p::GFP + F58E10 (cosmid) + unc-119(+)] IV. Heterozygous strain. Wild-type hermaphrodites segregating wild-type, Dpy-18, and dead eggs (subs-4 homozygotes). Pick wild-type to maintain. Reference: Gravato-Nobre et al (in preparation).
|
|
| CB7272 |
C. elegans |
ccIs4251 I; mIs12 II; dpy-17(e164) III; frIs7 IV; uIs69 V. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. mIs12 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. uIs69 [pCFJ90(myo-2p::mCherry) + unc-119p::sid-1] V. Mapping strain. This strain is homozygous for integrated fluorescence markers on LG I, II, IV and V, all of which are easily and independently scored using a fluorescent dissecting microscope, plus an easily scored visible marker (dpy-17) for LGIII. The good markers on all five autosomes facilitate linkage assignment of unmapped mutations, and enable rapid replacement of chromosomes when outcrossing heavily mutagenized strains such as those from the Million Mutation Project.
|
|
| CB7401 |
C. elegans |
unc-119(ed3) III; bah-2(gk487599) IV; eEx835. Show Description
eEx835 [bah-2(+) + unc-119(+)]. Pick wild-type to maintain. bah-2(gk487599) rescued by transgene. Reference: O'Rourke et al (in preparation).
|
|
| CB7403 |
C. elegans |
bah-3(br9) I; bah-2(gk487599) IV. Show Description
Bah (resistant to Yersinia biofilm formation). Reference: Hodgkin et al (in preparation).
|
|
| CB7410 |
C. elegans |
bah-1(ok2197) I; bah-2(gk487599) IV. Show Description
Bah (resistant to Yersinia biofilm formation). Reference: Hodgkin et al (in preparation).
|
|
| CB7427 |
C. elegans |
unc-17(e245) IV; eEx849. Show Description
eEx849 [C28H8.4(sdmV186E)]. unc-17 missense mutant suppressed by missense C28H8.4 transgene. Pick non-Unc hermaphrodites to maintain. Animals that have lost the array are severely Unc (coilers). Reference: Stroud et al (in preparation).
|
|
| CB7430 |
C. elegans |
unc-17(e245) IV; eEx855. Show Description
eEx855 [erd-2(sdmV186E) + sur-5p::GFP]. unc-17 missense mutant partly suppressed by missense erd-2 (a.k.a. sup-2) transgene. Pick GFP+ (weak Unc) hermaphrodites to maintain. Animals that have lost the array are severely Unc (coilers). Reference: Stroud et al (in preparation).
|
|
| CB7476 |
C. elegans |
him-8(e1489) IV; galt-1(op497) V. Show Description
Him. Resistant to fungal toxin CGL2; weakly resistant to Leucobacter Verde1. Him strain derived from pmk-1;galt-1 double mutant. References: Butschi et al (2010). O'Rourke et al (in preparation).
|
|
| CB7505 |
C. elegans |
him-8(e1489) IV; ptr-15(cr52) V; eEx730. Show Description
eEx730 [ptr-15(+) + sur-5p::GFP]. Pick GFP+ to maintain. Him. Lethal 1118bp deletion allele of ptr-15 rescued by eEx730. Non-GFP animals will be dead eggs and dead hatchlings. References: ORourke et al. (in revision 2024), Kuwabara et al. (in prep.)
|
|
| CB7516 |
C. elegans |
bus-10(e2702) IV; bus-28(gk236264) V. Show Description
Viable, Bus (M. nematophilum resistant), resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1. Reference: O'Rourke et al (in preparation).
|
|
| CB7549 |
C.elegans |
bus-4(br4) IV. Show Description
Q288Stop(UAA). Reference null. Surface abnormal, resistant to M. nematophilum and Leucobacter Verde2, killed by Leucobacter Verde1. References: Darby C, et al. Genetics. 2007 May;176(1):221-30. doi: 10.1534/genetics.106.067496. Epub 2007 Mar 4. PMID: 17339204. ORourke D, et al. G3 (Bethesda). 2023 May 2;13(5):jkad056. doi: 10.1093/g3journal/jkad056. PMID: 36911920.
|
|
| CB791 |
C. elegans |
unc-5(e791) IV. Show Description
Superficially wild-type. References: Rosu S, et al. Science. 2011 Dec 2;334(6060):1286-9. doi: 10.1126/science.1212424. PMID: 22144627. Toraason E, et al. Curr Biol. 2021 Apr 12;31(7):1508-1514.e5. doi: 10.1016/j.cub.2021.03.008. Epub 2021 Mar 18. PMID: 33740427. Toraason E, et al. Elife. 2024 Aug 8;13:e80687. doi: 10.7554/eLife.80687. PMID: 39115289.
|
|
| CB845 |
C. elegans |
unc-30(e191) IV. Show Description
Unc-cannot back up.
|
|
| CB927 |
C. elegans |
eDf28 IV. Show Description
Unc-weak kinker. Fairly active. Healthy. See WBPaper00002474. Previously called unc-24(e927).
|
|
| CB928 |
C. elegans |
unc-31(e928) IV. Show Description
Unc-very slow and sluggish. Insensitive to prodding. Egl. Constitutive pharyngeal pumping. Long lived.
|
|
| CB933 |
C. elegans |
unc-17(e245) IV. Show Description
M-MATING-NO SUCCESS. UNC-Severe coiler at all stages-small and thin. SCORED EASILY. Suppressed by sup-1, sup-2, and snb-1. Resistant to lannate. See also CGC 1770.
|
|
| CB96 |
C. elegans |
vab-2(e96) IV. Show Description
Notched head. Tail abnormalities. Variable expression. Incomplete penetrance. Especially seen in L1. M-MATING++++ >30%WT. See also WBPaper00003843 and WBPaper00003865. Previously called efn-1(e96).
|
|
| CER348 |
C. elegans |
trxr-1(cer35[Sec666C]) IV. Show Description
Missense mutation selenocysteine to cysteine. Resistant to cisplatin exposure. Primers to genotype this missense mutation and other silent mutations: [Common Fw: GGCTTCCACATTCTCACTCC] [RV wildtype: CTTAACCTCAGCAACCAGAA] [RV Sec to Cys: CTTAACCGCAACATCCGCTG] Reference: García-Rodríguez FJ, et al. Dis Model Mech. 2018 Jun 21;11(6).
|
|
| CER36 |
C. elegans |
lsm-1(tm3585) II; lsm-3(tm5166) IV. Show Description
Maintain at 15C. Temperature sensitive. Reduced brood size, Sma. Reference: Cornes E, et al. RNA. 2015 Sep;21(9):1544-53.
|
|
| CER374 |
C. elegans |
trxr-1(cer55[Sec666X]) IV. Show Description
Missense mutation engineered by CRISPR removes a selenocysteine to place a stop codon. Resistance to cisplatin exposure. Primers to genotype the cer55 and other silent mutations: [Common Fw: #1224 GGCTTCCACATTCTCACTCC] [RV wildtype: #1414 cTTAACCTCAGCAACCAGAA] [RV Sec to STOP: #1421 CTTAACCTTAACATCCGCTG] Reference: García-Rodríguez FJ, et al. Dis Model Mech. 2018 Jun 21;11(6).
|
|
| CF1135 |
C. elegans |
egl-20(n585) IV; muEx68. Show Description
muEx68 [(pJW33) myo-2p::egl-20::GFP + (7PD10.46) unc-22 (antisense)]. Use nicotine or levamisole to pick twitchers. Reference: Whangbo J & Kenyon C, (1999) Mol Cell 4(5):851-8.
|
|
| CF1170 |
C. elegans |
egl-20(n585) IV; muEx79. Show Description
muEx79 [(pJW33) myo-2p::egl-20::GFP + (7PD10.46) unc-22 (antisense)]. Use nicotine or levamisole to pick twitchers. Reference: Whangbo J & Kenyon C, (1999) Mol Cell 4(5):851-8.
|
|
| CF12 |
C. elegans |
rol-6(e187) II; lin-22(n372) IV; him-5(e1490) V. Show Description
Rollers. lin-22 and him-5 mutations affect neuroblast formation from epidermal precursor cell V5.
|
|
| CF1844 |
C. elegans |
rrf-3(b26) II; daf-2(mu150) III; fem-1(hc17) IV. Show Description
Long lifespan. Maintain at 15C. Worms develop slowly at 20C, and are sterile at 25C. Reference: Garigan D, et al. Genetics. 2002 Jul;161(3):1101-12.
|
|
| CF1864 |
C. elegans |
daf-10(mu377) IV. Show Description
Temperature-sensitive allele of daf-10 exhibits dye filling (Dyf) phenotype at 25C and non-Dyf at 20C.
|
|
| CF237 |
C. elegans |
muIs2 unc-31(e169) IV. Show Description
muIs2 [mab-5::lacZ + unc-31(+)]. non-Unc.
|
|
| CF26 |
C. elegans |
lin-22(mu2) IV; him-5(e1490) V. Show Description
Alae-to-ray transformation similar to that of n372 animals.
|
|
| CF263 |
C. elegans |
egl-20(mu39) IV. Show Description
QL migration defect. HSN migratin defect.
|
|
| CF267 |
C. elegans |
muIs6 IV. Show Description
muIs6 [lin-39::lacZ + rol-6(su1006)] IV. lin-39 promoter driving lacZ. muIs6 was integrated by gamma irradiation.
|
|
| CF301 |
C. elegans |
mab-5(e2088) III; unc-31(e169) IV; him-5(e1490) V; muIs9 X. Show Description
muIs9 [hs-mab-5 + C14G10]. Heat-shock inducible mab-5. C14G10 contains a WT copy of unc-31. muIs9 integrated by gamma irradiation.
|
|
| CF31 |
C. elegans |
lin-22(mu5) IV; him-5(e1490) V. Show Description
Alae-to-ray transformation similar to that of n372 animals.
|
|
| CF32 |
C. elegans |
lin-1(e1026) IV; him-5(e1490) V. Show Description
Very slow growth.
|
|
| CF36 |
C. elegans |
lin-22(n372) unc-33(e204) IV. Show Description
Desorption
|
|
| CF439 |
C. elegans |
lin-39(mu26) III; dpy-20(e1282) IV; him-5(e1490) V; muIs23. Show Description
muIs23 [hsp::lin-39 + (pMH86) dpy-20(+)]. Heat-shock inducible lin-39. muIs23 is a spontaneous integrant whose chromosomal location is unknown. [NOTE: This strain was previously described as carrying lin-39(n1760), but it is actually carrying the g to a substitution of mu26. Strain MT7255 has been confirmed to be carrying the a to t substitution of n1760.]
|
|
| CF453 |
C. elegans |
muIs16 II; dpy-20(e1282) IV. Show Description
muIs16 [mab-5::GFP + dpy-20(+)]. non-Dpy.
|
|
| CF4610 |
C. elegans |
muIs257 I. Show Description
muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Muscle-specific expression of wrmScarlet1-10 (Under the control of the myo-3 promoter and unc-54 3'UTR). Generated using CRISPR/Cas9 in the SKI-LODGE strain WBM1126. Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249
|
|
| CF4639 |
C. elegans |
glh-1(sam140[glh-1::T2A::wrmScarlet(1-10)]) I; fib-1(mu498[wrmScarlet11::fib-1]) V. Show Description
fib-1(mu498[wrmScarlet11::fib-1]) generated via CRISPR/Cas9 insertion into parental strain DUP237; transgene contains a linker between wrmScarlet11 and fib-1. Endogenous fib-1 detectable in the germline. T2A::wrmScarlet(1-10) fused to the C-terminus of endogenous GLH-1. The T2A self-cleaving peptide separates wrmScarlet(1-10) from GLH-1 post-translationally so that wrmScarlet(1-10) disperses throughout germ cell nuclei and cytoplasm. wrmScarlet(1-10) is also maternally loaded into embryos, where it persists through early and mid-embryonic development. Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249. Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
|
|
| CF512 |
C. elegans |
rrf-3(b26) II; fem-1(hc17) IV. Show Description
Grow at 15C. Sterile at 25C.
|
|
| CF579 |
C. elegans |
dpy-20(e1282) IV; him-5(e1490) V; muIs27. Show Description
muIs27 [mig-2::GFP + dpy-20(+)]. Him. non-Dpy. GFP is membrane enriched and expressed in many cells throughout development (see reference for details). Not known in which LG muIs27 is integrated.
|
|
| CF65 |
C. elegans |
mab-5(e2088) III; lin-22(n372) IV; him-5(e1490) V. Show Description
mab-5 mutation affects ectodermal and mesodermal lineages. lin-22 and him-5 mutations affect neuroblast formation from the epidermal precursor cell V5.
|
|