| CHS1087 |
C. elegans |
ser-3(yum1518) I; ser-6(yum1519) IV; octr-1(yum1517) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1106 |
C. elegans |
srj-42(yum1624) IV; srj-53(yum1630) srj-52(yum1629) srj-37(yum1620) srj-38(yum1621) srj-50(yum1628) srj-45(yum1626) srj-44(yum1625) srj-49(yum1627) srj-57(yum1633) srj-55(yum1632) srj-54(yum1631) srj-40(yum1623) srj-39(yum1622) srj-33(yum1619) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1107 |
C. elegans |
srx-19(yum1634) IV; srx-24(yum1635) srx-26(yum1636) srx-28(yum1637) srx-29(yum1638) srx-31(yum1639) srx-32(yum1640) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1111 |
C. elegans |
srsx-14(yum1656) srsx-15(yum1657) srsx-16(yum1658) IV; srsx-17(yum1659) srsx-18(yum1660) srsx-19(yum1661) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1112 |
C. elegans |
srz-58(yum1662) V; srz-59(yum1663) srz-60(yum1664) srz-61(yum1665) srz-62(yum1666) IV; srz-85(yum1667) I. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1120 |
C. elegans |
fshr-1(yum1706) V; npr-42(yum1703) II; npr-36(yum1704) pcdr-1(yum1707) X; tag-89(yum1705) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1121 |
C. elegans |
npr-19(yum1708) X; npr-23(yum1709) I; h23l24.4(yum1711) t02d1.4(yum1712) IV; zk813.5(yum1710) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1122 |
C. elegans |
srz-69(yum1715) srz-70(yum1716) srz-71(yum1717) srz-104(yum1713) srz-105(yum1714) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1124 |
C. elegans |
t06e4.7(yum1724) V; y32h12a.1(yum1726) III; y77e11a.16(yum1725) IV; zk6.6(yum1728) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1129 |
C. elegans |
srt-54(yum1749) II; srt-55(yum1750) III; srt-56(yum1751) V; srt-61(yum1752) srt-62(yum1753) I; srt-73(yum1754) IV; f49d11.11(yum1755) I. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1130 |
C. elegans |
srz-25(yum1757) V; srz-29(yum1758) srz-31(yum1759) srz-32(yum1760) srz-37(yum1761) srz-38(yum1762) srz-72(yum1762) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1136 |
C. elegans |
srz-42(yum1789) IV; srz-44(yum1790) srz-47(yum1791) srz-48(yum1792) srz-54(yum1793) V; srz-56(yum1794) III. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1139 |
C. elegans |
srz-16(yum1808) srz-18(yum1809) V; srz-19(yum1810) srz-20(yum1811) srz-23(yum1813) srz-24(yum1812) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1142 |
C. elegans |
c04c3.6(yum1830) c04c3.7(yum1835) IV; c50h11.13(yum1832) c54e10.3(yum1833) V; t01b11.1(yum1834) IV; zk863.1(yum1831) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1145 |
C. elegans |
srab-1(yum1849) srab-2(yum1850) srab-3(yum1851) srab-4(yum1852) srab-13(yum1853) srab-23(yum1854) V; k08b5.1(yum1856) X; y41d4b.1(yum1855) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1146 |
C. elegans |
srx-48(yum1857) V; srx-50(yum1858) IV; srx-51(yum1859) srx-54(yum1860) srx-59(yum1862) srx-64(yum1863) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1148 |
C. elegans |
fmil-1(yum1873) IV; gpr-158(yum1872) I; tmem-145(yum1871) t04f8.2(yum1870) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1162 |
C. elegans |
srv-11(yum1961) srv-12(yum1962) srv-13(yum1963) srv-14(yum1964) srv-15(yum1965) srv-16(yum1966) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1166 |
C. elegans |
str-78(yum1987) IV; str-79(yum1988) X; str-81(yum1989) str-82(yum1990) str-83(yum1991) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1169 |
C. elegans |
srd-10(yum2006) IV; srd-11(yum2007) V; srd-12(yum2008) IV; srd-13(yum2009) IV; srd-15(yum2010) srd-16(yum2011) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1175 |
C. elegans |
srg-46(yum2038) srg-47(yum2039) V; srg-48(yum2040) srg-50(yum2041) srg-51(yum2042) IV; srg-53(yum2043) V; y54g2a.38(yum2045) y54g2a.77(yum2044) IV; ah9.1(yum2046) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1176 |
C. elegans |
str-170(yum2047) str-171(yum2048) str-172(yum2049) str-173(yum2050) str-174(yum2051) str-175(yum2052) str-166(yum2053) y9c9a.5(yum2054) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1183 |
C. elegans |
str-185(yum2093) str-188(yum2094) str-187(yum2095) str-190(yum2096) str-178(yum2097) y116a8c.40(yum2098) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1185 |
C. elegans |
f49e11.2(yum2105) f57c9.6(yum2106) zc266.1(yum2107) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1196 |
C. elegans |
srd-23(yum2172) srd-25(yum2173) srd-26(yum2174) srd-27(yum2175) srd-28(yum2176) srd-29(yum2177) srd-30(yum2178) srd-31(yum2179) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1203 |
C. elegans |
t27e7.9(yum1046) t27e7.4(yum1047) t27e7.5(yum1048) t27e7.3(yum1049) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1217 |
C. elegans |
sru-16(yum2308) sru-17(yum2309) sru-18(yum2310) sru-19(yum2311) sru-20(yum2312) sru-42(yum2313) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1218 |
C. elegans |
sru-21(yum2314) sru-22(yum2315) sru-23(yum2316) sru-24(yum2317) sru-25(yum2318) sru-26(yum2319) sru-27(yum2320) sru-28(yum2321) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1220 |
C. elegans |
srm-1(yum2328) srm-2(yum2329) srm-3(yum2330) srm-4(yum2331) srm-5(yum2332) srm-6(yum2333) srn-1(yum2334) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1229 |
C. elegans |
sru-1(yum2381) sru-2(yum2382) sru-3(yum2383) sru-4(yum2384) sru-6(yum2385) sru-8(yum2386) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1235 |
C. elegans |
srv-24(yum2423) srv-25(yum2424) srv-26(yum2425) srv-27(yum2426) srv-28(yum2427) srv-29(yum2428) srv-30(yum2429) srv-31(yum2430) srv-32(yum2431) ops-1(yum2432) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1265 |
C. elegans |
str-3(yum1042) str-4(yum2669) str-5(yum2670) str-1(yum2671) str-6(yum2672) str-7(yum2673) str-9(yum2674) c04c3.7(yum2675) str-8(yum2676) t23d5.8(yum2677) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1680 |
C. elegans |
srtx-1(yum2906) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1681 |
C. elegans |
tpra-1(yum2907) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CL6180 |
C. elegans |
smg-1(cc546) I; dvIs19 III; skn-1(zu67)/nT1 [unc-?(n754) let-?] (IV;V); dvIs27 X. Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Roller with weak constitutive GFP expression. Balanced strain, segregates Rol Uncs [skn-1(zu67) heterozygotes], Rol nonUncs [skn-1(zu67) homozygotes] and dead eggs. Maintain by picking Rol Uncs. Paralyzed if upshifted as larvae to 25C. References: Dostal, V and Link CD (2010) J Vis Exp. Oct 9;(44). Dostal V, Roberts CM, Link CD (2010) Genetics Nov;186(3):857-66. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
| CL691 |
C. elegans |
dvIs19 III; skn-1(zu67) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Segregates Unc skn-1(zu67) heterozygotes, arrested eggs/larvae (nT1 homozygotes), and wild type skn-1(zu67) homozygotes (sterile). All genotypes show constitutive weak GFP expression. Upon exposure to SKN-1 inducers (e.g., azide), strong induction of GFP is observered in skn-1/+ hets; there is no induction in skn-1 homozygotes. Pick Uncs to maintain -- although this strain is nominally balanced, nT1 can break down. Reference: Dostal, V., et al. Genetics. 2010 Nov;186(3):857-66.
|
|
| CLP1360 |
C. elegans |
pmp-4(twn16) IV. Show Description
twn16 is a 1651 bp deletion removing 1027 bp of the promoter sequence, the transcriptional start site, and the first two exons of pmp-4. Superficially wild-type. Normal dauer formation. Reference: Tsai SH, et al. Cell Rep. 2024 Mar 22;43(4):113996. doi: 10.1016/j.celrep.2024.113996. PMID: 38520690.
|
|
| CLP1445 |
C. elegans |
pmp-4(twn16) IV; twnEx656. Show Description
twnEx656 [pmp-4p::pmp-4 + elt-2p::GFP]. Pick GFP+ animals to maintain. Superficially wild-type. twnEx656 contains 1.2 kb pmp-4 promoter driving expression of 2.2 kb pmp-4 cDNA; transgene rescues behavioral phenotype of twn16 mutants. twn16 is a 1651 bp deletion removing 1027 bp of the promoter sequence, the transcriptional start site, and the first two exons of pmp-4. twn16 has been out-crossed 3 times in this strain. Reference: Tsai SH, et al. Cell Rep. 2024 Mar 22;43(4):113996. doi: 10.1016/j.celrep.2024.113996. PMID: 38520690.
|
|
| COP1626 |
C. elegans |
ins-34(knu572) IV. Show Description
F52B11.6. Superficially wild-type. knu572 is an F125L point mutation mimicking human mutation F119L in patients with PMM2 deficiency disease. Strain is sensitive to bortezomib (proteasome blocker) and displays larval arrest in liquid culture. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information.
|
|
| COP2341 |
C. elegans |
spin-2(knu1018[spin-2::mCherry::loxP::HygR::loxP]) IV. Show Description
mCherry tag inserted at the C-terminus of the endogenous spin-2 locus via CRISPR/Cas9 engineering. This strain may not be distributed to commercial or for-profit entities without prior written permission from In Vivo Biosystems. Please contact support@invivobiosystems.com for more information. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394.
|
|
| COP2772 |
C. elegans |
oma-1(knu1284[delta TZF])::GFP IV; oma-2(ne5034[AID*::oma-2] neSi101 V. Show Description
knu1284 is a CRISPR-engineered in-frame deletion of the TZF domain of oma-1. AID* degron tag (IAA17) inserted into the endogenous oma-2 locus. When OMA-2 is present, this mutant does not appear to have obvious phenotypes. Auxin-inducible depletion of OMA-2 causes a null phenotype: animals do not produce mature embryos and have an empty uterus. Reference: Ertekin A, et al. bioRxiv. 2025 May 12:2025.05.09.653132. doi: 10.1101/2025.05.09.653132. PMiD: 40463014.
|
|
| CP87 |
C. briggsae |
Cbr-fem-3(nm63) IV. Show Description
XO are self-fertile hermaphrodites with low brood size and some somatic gonad defects. XX animals have normal brood size.
|
|
| CP89 |
C. briggsae |
Cbr-fem-2(nm27) III; Cbr-fem-3(nm63) IV. Show Description
XX are self-fertile hermaphrodites.
|
|
| CSG10 |
C. elegans |
gsgIs1 IV. Show Description
gsgIs1 [synthetic 900 bp HA1 left::dpy-10 cRNA site:: synthetic 900 bp HA2 right] (IV: 5014948). Superficially wild-type. gsgIs1 can be used to generate single-copy insertions in C. elegans Chromosome IV. This strain is part of the SKI PLACE System, which can be used to generate single-copy insertions into the C. elegans genome at specific safe harbor locations on each chromosome through CRISPR-Cas9-mediated insertion. The system uses a single plasmid, pSKI (Addgene #232484), to insert transgenes at specific genomic locations. Generated in N2 background. Reference: Dinneen E, et al. G3 (Bethesda). 2025 Sep 19:jkaf220. doi: 10.1093/g3journal/jkaf220. PMID: 40973646.
|
|
| CU1715 |
C. elegans |
psr-1(tm469) IV. Show Description
968 bp deletion. Engulfment defects.
|
|
| CU6372 |
C. elegans |
drp-1(tm1108) IV. Show Description
Homozygous viable. Slow growth but not lethal or sterile. Reference: Breckenridge DG, et al. Mol Cell. 2008 Aug 22;31(4):586-97.
|
|
| CU7905 |
C. elegans |
smIs350 IV; unc-76(e911) V. Show Description
smIs350 [hsp-16::mCherry-NLS + tra-2::FLAG(3x) + unc-76(+)] IV. Some sterility. Maintain under normal conditions. Reference: Mapes J, et al. (2010) PNAS In press.
|
|
| CV138 |
C. elegans |
sgo-1(tm2443) IV. Show Description
tm2443 is a 204 bp deletion + 7 bp insertion in 21762/21763-TTTTCTC-21966/21967. A low penetrance (1/25) of chromosome bridges is observed at anaphase I. Reference: de Carvalho et al., Genes Dev 22, 2869-2885.
|
|
| CV199 |
C. elegans |
fan-1(tm423) IV/nT1 [qIs51] (IV;V). Show Description
Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP fan-1 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Smogorzewska A, et al. (2010) Molec Cell 39:36-47.
|
|
| CVB39 |
C. elegans |
siss-1(csn20) IV. Show Description
siss-1(csn20) homozygotes are defective in stress-induced sleep (SIS) but otherwise normal (homozygous viable, fertile, morphologically and behaviorally wild-type). siss-1, formerly known as igeg-1, encodes an EGFR ligand. The csn20 mutation is a single amino acid substitution of one of the conserved Cysteines within the EGF domain and phenocopies deletion alleles of this gene. Reference: Hill et al. 2024. In preparation.
|
|
