| CF693 |
C. elegans |
unc-31(e169) IV; him-5(e1490) V; muIs28. Show Description
muIs28 [mig-2::GFP + unc-31(+)]. muIs28 is not mapped, but probably on LG II by process of elimination.
|
|
| CF716 |
C. elegans |
dpy-20(e1282) IV; mig-13(mu31) X; muIs37. Show Description
muIs37 [(pMS114) hsp::mig-13 + (pMH86) dpy-20(+)]. Inducible heat-shock promoter driven mig-13 rescues Q cell migration defects in mig-13(mu31) mutants. Reference: Sym, M., Robinson, N., and Kenyon, C. Cell. 1999 Jul 9;98(1):25-36.
|
|
| CF891 |
C. elegans |
dpy-20(e1282) IV; muIs37. Show Description
muIs37 [(pMS114) hsp::mig-13 + (pMH86) dpy-20(+)]. Inducible heat-shock promoter driven mig-13 rescues Q cell migration defects in mig-13(mu31) mutants. Reference: Sym, M., Robinson, N., and Kenyon, C. Cell. 1999 Jul 9;98(1):25-36.
|
|
| CF896 |
C. elegans |
dpy-20(e1282) IV; muIs42. Show Description
muIs42[mig-13::GFP + dpy-20(+)]. non-Dpy strain. GFP+ in ventral cord cells, pharyngeal-intestinal valve cells.
|
|
| CF978 |
C. elegans |
unc-24(e138) IV; bar-1(mu349) X. Show Description
Unc. QL descendants in a mutant position (anterior of ALM). Okay to grow at 15 or 20C.
|
|
| CF980 |
C. elegans |
egl-20(n585) IV; bar-1(mu349) X. Show Description
Egl. QL descendants in a mutant position (anterior of ALM). Okay to grow at 15 or 20C.
|
|
| CFJ192 |
C. elegans |
unc-119(ed3) III; kstSi37 IV; kstEx46. Show Description
kstSi37 [Cbr-unc-119(kst13)] IV. kstEx46 [hsp-16.41p::Cas9::gpd-2::TagRFP-T::smu-1 3'UTR + mlc-1p::mCherry + NeoR]. Pick mCherry+ to maintain. Unc. Cbr-unc-119(kst13) is a partial unc-119 used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Reference: El Mouridi S, et al. 2022.
|
|
| CFJ94 |
C. elegans |
unc-119(ed3) III; kstSi37 IV. Show Description
kstSi37 [Cbr-unc-119(kst13)] IV. Unc. Cbr-unc-119(kst13) is a partial unc-119 used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Reference: El Mouridi S, et al. 2022.
|
|
| CG118 |
C. elegans |
unc-43(sy574) IV; him-5(e1490) V. Show Description
Males constitutively protract their spicules in the absence of mating cues.
|
|
| CG460 |
C. elegans |
unc-43(sy574) IV; him-5(e1490) V; rgEx161. Show Description
rgEx161[lev-11p::UNC-43g + gtl-1p::CFP]. rgEx161 rescues unc-43(sy574)-induced spicule protraction.
|
|
| CGC10 |
C. elegans |
umnTi7 IV. Show Description
umnTi7 [eft-3p::GFP + unc-119(+)] IV. Integration site: (IV:+14.35 cM/nt 15,997,713). Might still contain unc-119(ed3) in background.
|
|
| CGC11 |
C. elegans |
unc-5(e53)/nT1 [umnIs1] IV; dpy-11(e224)/nT1 V. Show Description
umnIs1 [eft-3p::GFP + HygroR, V:~2821000] V. umnIs1 GFP is expressed at low levels, and might be difficult to see in heterozygotes. Heterozygotes are WT and segregate WT, DpyUnc, Vul and dead eggs. Maintain by picking GFP+ WT. Derived by insertion of GFP transgene into parental strain MT1000 using MosSCI.
|
|
| CGC13 |
C. elegans |
unc-5(e53)/nT1 [umnIs3] IV; dpy-11(e224)/nT1 V. Show Description
umnIs3 [eft-3p::NLS::tdTomato + HygroR, V:~2821000] IV. tdTomato is expressed at low levels, and might be difficult to see in heterozygotes. Heterozygotes are WT and segregate WT, DpyUnc, Vul and dead eggs. Maintain by picking WT with tdTomato expression. Derived by insertion of tdTomato transgene into parental strain MT1000 using CRISPR/Cas9.
|
|
| CGC143 |
C. elegans |
mir-1021(umn50[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) IV. Show Description
mir-1021 pre-miRNA deletion allele in which mir-1021 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
| CGC194 |
C. elegans |
dpy-26(n199)/tmC5 [F36H1.3(tmIs1220)] IV. Show Description
Lethal/sterile dpy-26 allele balanced over tmC5 labelled with Venus. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus n199 homozygotes (variable morphology). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Derived by crossing parental strains FX30140 with CB5101 (males).
|
|
| CGC30 |
C. elegans |
unc-30(e191) dpy-4(e1166) IV; yDp1 [umnIs19] (IV;V;f). Show Description
umnIs19 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)]. Animals with the Dup are wild-type GFP+; animals that have lost the Dup are Dpy Unc GFP-. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into yDp1 duplication in parental strain TY156 using CRISPR/Cas9.
|
|
| CGC33 |
C. elegans |
unc-5(e53)/nT1 [umnIs22] IV; dpy-11(e224)/nT1 V. Show Description
umnIs22 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, Vul GFP+ (nT1) and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
|
|
| CGC39 |
C. elegans |
unc-5(e53)/nT1 IV; dpy-11(e224)/nT1 [umnIs28] V. Show Description
umnIs28 [myo-2p::GFP + NeoR, IV: 12457861 (intergenic)] V. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, Vul GFP+ (nT1) and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
|
|
| CGC63 |
C. elegans |
unc-5(e53)/nT1 [umnIs49] IV; dpy-11(e224)/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, Vul mKate2+ (nT1) and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
|
|
| CGC64 |
C. elegans |
unc-30(e191) dpy-4(e1166) IV; yDp1 [umnIs50] (IV;V;f). Show Description
umnIs50 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)]. Animals with the Dup are wild-type mKate2+; animals that have lost the Dup are Dpy Unc mKate2-. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into yDp1 duplication in parental strain TY156 using CRISPR/Cas9.
|
|
| CGC71 |
C. elegans |
unc-5(e53)/nT1 IV; dpy-11(e224)/nT1 [umnIs57] V. Show Description
umnIs57 [myo-2p::mKate2 + NeoR, IV: 12457861 (intergenic)] V. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, Vul mKate2+ (nT1) and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
|
|
| CGC78 |
C. elegans |
C04C3.6(umn8[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| CGC8 |
C. elegans |
umnTi5 IV. Show Description
umnTi5 [eft-3p::GFP + unc-119(+)]. Integration site: (IV:+8.48 cM/nt 13,215,045). Might still contain unc-119(ed3) in background.
|
|
| CH116 |
C. elegans |
hsb-1(cg116) IV. Show Description
Viable and fertile. Deletion of 664 bp, molecular null.
|
|
| CHS1014 |
C. elegans |
sru-47(yum1163) I; sru-7(yum1159) IV; c45h4.18(yum1162) sru-44(yum1160) sru-45(yum1161) V; sru-48(yum1164) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1016 |
C. elegans |
gbb-2(yum1169) IV; gbb-1(yum1168) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1017 |
C. elegans |
y40c5a.4(yum1171) IV; c47e8.3(yum1172) f57a8.4(yum1170) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1018 |
C. elegans |
b0034.5(yum1175) II; f56a11.4(yum1174) y37e11al.1(yum1173) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1020 |
C. elegans |
k03h6.1(yum1032) k03h6.5(yum1031) r13h7.2(yum1030) IV; t10e10.3(yum1033) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1025 |
C. elegans |
frpr-10(yum1196) IV; frpr-9(yum1195) V; frpr-7(yum1193) frpr-8(yum1194) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1026 |
C. elegans |
frpr-19(yum1199) IV; frpr-13(yum1197) frpr-15(yum1198) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1029 |
C. elegans |
sru-35(yum1218) IV; sru-29(yum1215) sru-30(yum1216) sru-31(yum1217) sru-36(yum1219) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1035 |
C. elegans |
str-153(yum1271) IV; str-154(yum1280) V; str-155(yum1272) str-156(yum1275) str-158(yum1276) str-159(yum1277) IV; str-160(yum1278) V; str-161(yum1279) str-162(yum1273) str-168(yum1274) IV; str-267(yum1281) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1036 |
C. elegans |
srh-61(yum1282) II; srh-62(yum1283) V; srh-63(yum1284) IV; srh-67(yum1285) srh-68(yum1286) srh-69(yum1287) srh-70(yum1288) srh-71(yum1289) srh-72(yum1290) srh-73(yum1291) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1044 |
C. elegans |
srh-220(yum1336) srh-222(yum1337) srh-223(yum1338) srh-227(yum1339) srh-228(yum1340) IV; srh-229(yum1341) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1049 |
C. elegans |
str-176(yum1363) IV; str-177(yum1364) str-178(yum1365) str-180(yum1366) str-181(yum1367) str-182(yum1368) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1052 |
C. elegans |
sre-13(yum1380) II; sre-14(yum1381) sre-15(yum1382) sre-16(yum1383) sre-18(yum1384) sre-19(yum1385) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1056 |
C. elegans |
sre-1(yum1398) sre-2(yum1399) sre-3(yum1400) II; sre-4(yum1401) sre-5(yum1402) IV; sre-6(yum1403) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1058 |
C. elegans |
npr-12(yum1406) IV; npr-9(yum1404) npr-11(yum1405) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1060 |
C. elegans |
srx-12(yum1413) srx-13(yum1414) srx-14(yum1415) IV; srx-33(yum1416) srx-34(yum1417) srx-36(yum1418) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1061 |
C. elegans |
tkr-1(yum1419) III; tkr-2(yum1420) tkr-3(yum1421) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1065 |
C. elegans |
npr-26(yum1429) npr-27(yum1430) IV; npr-25(yum1428) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1066 |
C. elegans |
srj-1(yum1431) IV; srj-4(yum1432) srj-5(yum1433) srj-6(yum1434) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1068 |
C. elegans |
sri-5(yum1445) I; sri-18(yum1441) V; sri-19(yum1442) IV; sri-20(yum1443) sri-21(yum1444) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1069 |
C. elegans |
npr-31(yum1446) II; npr-32(yum1447) IV; npr-33(yum1448) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1070 |
C. elegans |
sru-13(yum1452) sru-12(yum1451) sru-11(yum1450) sru-9(yum1449) sru-15(yum1453) IV; sru-40(yum1454) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1074 |
C. elegans |
srxa-5(yum1470) III; srxa-2(yum1468) IV; srxa-4(yum1469) srxa-7(yum1472) srxa-1(yum1467) srxa-6(yum1471) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1075 |
C. elegans |
str-166(yum1476) str-169(yum1477) str-163(yum1473) str-164(yum1474) IV; str-165(yum1475) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1077 |
C. elegans |
srz-74(yum1480) srz-75(yum1481) srz-78(yum1482) srz-79(yum1483) srz-82(yum1484) srz-83(yum1485) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1079 |
C. elegans |
npr-34(yum1491) II; npr-35(yum1492) npr-22(yum1489) IV; npr-24(yum1490) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
