| ESK6 |
C. elegans |
unc-119(ed3) III; aak-2(ok524) X; fphIs3. Show Description
fphIs3 [rab-3p::aak-2A::GFP + unc-119(+)]. aak-2A isoform expressed from the neuronal rab-3 promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384.
|
|
| ESK7 |
C. elegans |
unc-119(ed3) III; aak-2(ok524) X; fphEx4. Show Description
fphEx4 [vha-6p::aak-2A::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. aak-2A isoform expressed from the intestinal vha-6 promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384.
|
|
| GR2255 |
C. elegans |
moc-2(mg595) V. Show Description
Can be maintained on OP50. Requires dietary Moco for viability. Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.
|
|
| GR2256 |
C. elegans |
F49E2.1(mg589) X. Show Description
F49E2.1. Can be maintained on OP50. Requires dietary Moco for viability. Reference: (F49E2.1 referred to as moc-5) Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.
|
|
| GR2257 |
C. elegans |
cth-2(mg599) II. Show Description
Can be maintained on OP50. Suppresses Moco-deficient larval lethality. Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.
|
|
| GR2260 |
C. elegans |
cdo-1(mg622) X. Show Description
Can be maintained on OP50. Suppresses Moco-deficient larval lethality. Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.
|
|
| GR3055 |
C. elegans |
suox-1(mg663)/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X Show Description
Larval lethal mutation balanced by tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)]. Balancer marked with myo-2p::Venus. Maintain by picking non-Unc GFP+ animals. Heterozygotes are wild-type GFP+ and segregate wild-type GFP+ heterozygotes, non-GFP mg663 homozygotes (lethal), and Unc GFP+ (homozygous tmC24). Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.
|
|
| GS416 |
C. elegans |
evl-6(ar120)/dpy-13(e184) unc-24(e138) IV. Show Description
Heterozygotes are WT (Dpyish) and segregate WT (Dpyish), DpyUncs and Steriles which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC.
|
|
| GS419 |
C. elegans |
evl-3(ar118)/dpy-10(e128) unc-4(e120) II; him-5(e1467) V. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Steriles which have an everted vulva. Throws males. Do not distribute this strain; other labs should request it from the CGC.
|
|
| HBR1907 |
C. elegans |
goeIs410. Show Description
goeIs410 [hsp-16.2p::cnc-6::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-6::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
| HBR1911 |
C. elegans |
goeIs411. Show Description
goeIs411 [hsp-16.2p::cnc-4::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-4::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
| HBR1912 |
C. elegans |
goeIs412. Show Description
goeIs412 [hsp-16.2p::cnc-7::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-7::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
| HBR1914 |
C elegans |
goeIs413. Show Description
goeIs413 [hsp-16.2p::cnc-9::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-9::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
| HS411 |
C. elegans |
ceh-20(os39) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. Segregate GFP- sterile Unc Psa (phasmid socket absent), very rare homozygous hT2 glowing animals, and dead eggs. ceh-20(os39) animals show defects in asymmetric T cell division.
|
|
| JH4072 |
C. elegans |
pgl-3(ax4517[pgl-3::3xFLAG]) V; meg-3(ax3054[meg-3::meGFP]) X. Show Description
3xFlag tag inserted at C-terminus of endogenous pgl-3 locus. Inserted into parental strain JH3503 meg-3(ax3054[meg-3::meGFP]). Reference: Ouyang JPT, et al. Nature Cell Biology 2022 (24)11291140. DOI: 10.1038/s41556-022-00940-w.
|
|
| JH4073 |
C. elegans |
pgl-3(ax4516[pgl-3(delta448-693)::3xFLAG]) V; meg-3(ax3054[meg-3::meGFP]) X. Show Description
3xFlag tag inserted at truncated C-terminus of endogenous pgl-3 locus. Inserted into parental strain JH3503 meg-3(ax3054[meg-3::meGFP]). Reference: Ouyang JPT, et al. Nature Cell Biology 2022 (24)11291140. DOI: 10.1038/s41556-022-00940-w.
|
|
| JK6694 |
C. elegans |
rajSi50 II; unc-119(ed3) III. Show Description
rajSi50 [gld-1p::GFP::H2B::gld-1 3'UTR + Cbr-unc-119(+)] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. GFP is visible in germline nuclei, low in distal germ cells, increases proximally, strong in oocytes. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa: slc314 GTCACCAAGTACACTTCCAGCAAG / slc311 TGGCAACATGATGTATGGCACA (100 bp band in FBEa wt). FBEb: slc314 GTCACCAAGTACACTTCCAGCAAG / slc304 GGGTTAGCGTTAAGATAACACA (~500 bp band in FBEb wt). References: Theil K, et al. Nature Commun. 2019 Sep 16;10(1):4205. doi: 10.1038/s41467-019-12050-7. PMID: 31527589. Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."
|
|
| KRA448 |
C. elegans |
kasEx157. Show Description
kasEx157 [unc-11p::C9 neuro + myo-2::GFP]. Pick GFP+ to maintain array. The transgene drives expression of 75 GGGGCC repeats under the control of unc-11 promoter. The repeats are flanked with human C9orf72 intronic sequences. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821
|
|
| KRA450 |
C. elegans |
kasEx159. Show Description
kasEx159 [unc-11p::(delta)C9 neuro + myo-2::GFP]. Pick GFP+ to maintain array. The transgene has the unc-11 promoter followed by nanoluciferase sequence and unc-54 3'UTR. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821
|
|
| KRA452 |
C. elegans |
kasEx161. Show Description
kasEx161 [unc-11p::UAG neuro + myo-2::GFP]. Pick GFP+ to maintain array. The transgene drives expression of 75 GGGGCC repeats under the control of unc-11 promoter. The repeats are flanked with human C9orf72 intronic sequences, but the upstream CUG is mutated to UAG. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821
|
|
| KRA522 |
C. elegans |
kasIs10. Show Description
kasIs10 [snb-1p::UAG ubi + myo-2::GFP]. The transgene drives expression of 75 GGGGCC repeats under the control of snb-1 promoter. The repeats are flanked with human C9orf72 intronic sequences, but the upstream CUG is mutated to UAG. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821
|
|
| KS411 |
C. elegans |
lin-17(n671) I; unc-119(e2498) III; him-5(e1490) V; mhIs9. Show Description
mhIs9 [lin-17::GFP]. Full length lin-17, expressed T.p cells. Rescues lin-17 mutants. unc-119(e2498) may no longer be in the background.
|
|
| LIU104 |
C. elegans |
dhs-28(ldr6) X; ldrIs1; ldrIs2. Show Description
ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. ldrIs2 [mdt-28p::mdt-28::mCherry + unc-76(+)]. ldr6 is G-to-A causing a G158E substitution. Super-sized lipid droplets. [NOTE: The positions indicated in the original Figure 1C of Xie, et al. (2019) are based on an incorrect sequence map and do not reflect the position of the affected amino acid or position in a spliced transcript. The G158E substitution site of the ldr6 mutant is correct and has been independently confirmed by sequence analysis in another lab.] Reference: Xie K, et al. Sci Rep. 2019 Oct 17;9(1):14902. doi: 10.1038/s41598-019-51399-z. PMID: 31624276
|
|
| LIU65 |
C.elegans |
dhs-28(ldr5) X; ldrIs1; ldrIs2. Show Description
ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. ldrIs2 [mdt-28p::mdt-28::mCherry + unc-76(+)]. ldr5 is C-to-T substitution causing a premature stop (Q139*). Super-sized lipid droplets. [NOTE: The positions indicated in the original Figure 1C of Xie, et al. (2019) are based on an incorrect sequence map and do not reflect the position of the affected amino acid or position in a spliced transcript. The Q139* premature stop in the ldr5 mutant is correct and has been independently confirmed by sequence analysis in another lab.] Reference: Xie K, et al. Sci Rep. 2019 Oct 17;9(1):14902. doi: 10.1038/s41598-019-51399-z. PMID: 31624276
|
|
| LIU86 |
C. elegans |
dhs-28(ldr4) X; ldrIs1; ldrIs2. Show Description
ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. ldrIs2 [mdt-28p::mdt-28::mCherry + unc-76(+)]. ldr4 is a G-to-A mutation in the splice donor site of Intron 1. Super-sized lipid droplets. [NOTE: The positions indicated in the original Figure 1C of Xie, et al. (2019) are based on an incorrect sequence map and do not reflect the position of the affected amino acid or position in a spliced transcript. The G-to-A mutation in the splice donor site is correct and has been independently confirmed by sequence analysis in another lab.] Reference: Xie K, et al. Sci Rep. 2019 Oct 17;9(1):14902. doi: 10.1038/s41598-019-51399-z. PMID: 31624276
|
|
| MD5017 |
C. elegans |
ced-3(dx228[ced-3::mNeonGreen]) IV. Show Description
mNeonGreen tag inserted at C-terminus of endogenous ced-3 locus. Generated in N2 background. Reference: Lambie EJ, et al. Cell Death Differ. 2025 Aug 27. doi: 10.1038/s41418-025-01567-8. PMID: 40866673.
|
|
| MD5018 |
C. elegans |
ced-4(dx226[ced-4::mNeonGreen]) III. Show Description
mNeonGreen tag inserted at C-terminus of endogenous ced-4 locus. Generated in N2 background. Reference: Lambie EJ, et al. Cell Death Differ. 2025 Aug 27. doi: 10.1038/s41418-025-01567-8. PMID: 40866673.
|
|
| MD5019 |
C. elegans |
ced-9(dx236[mNeonGreen::ced-9]) III. Show Description
mNeonGreen tag inserted at N-terminus of endogenous ced-9 locus. Generated in N2 background. Reference: Lambie EJ, et al. Cell Death Differ. 2025 Aug 27. doi: 10.1038/s41418-025-01567-8. PMID: 40866673.
.
|
|
| MIR260 |
C. elegans |
risIs31. Show Description
risIs31 [hsp-16.2p::grh-1b::GFP + unc-119(+)]. Long lived without heat shock. Heat shock induces over-expression of grh-1 causing short-lived phenotype and nuclear GFP expression. Described as "hsp-16.2p::grh-1::gfp OEx line 1" in referenced paper. Reference: Grigolon G, et al. Nat Commun. 2022 Jan 10;13(1):107. doi: 10.1038/s41467-021-27732-4. PMID: 35013237.
|
|
| MIR262 |
C. elegans |
risls32. Show Description
risls32 [grh-1p::grh-1b::GFP + unc-119(+)]. Over-expression of grh-1 from its endogenous promoter. Short lived, no GFP signal visible. Reference: Grigolon G, et al. Nat Commun. 2022 Jan 10;13(1):107. doi: 10.1038/s41467-021-27732-4. PMID: 35013237.
|
|
| MSB1088 |
C. elegans |
unc-119(ed3) III; mirIs110 V. Show Description
mirIs110 [odr-7p::TeNL + unc-122p::GFP *oxTi553 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]] V. GFP expression in coelomycetes. Integration of the calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) into tdTomato in the oxTi553 insertion. Expression of TeNL transgene in AWA by the odr-7 promoter. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|
| MSB1091 |
C. elegans |
mirSi16 II; unc-119(ed3) III; mirIs110 V; mirIs107. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirIs110 [odr-7p::TeNL + unc-122p::GFP *oxTi553 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]] V. mirIs107 [gpa:14p::CRE + npr-9p::ChR-HRDC::YFP::SL2::jRGECO1a + rps-0p::hygroR]. Blue fluorescence in flp-18 expressing neurons. Green coelomycetes segregates with calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in AWA. ChR2-HRDC and jRGECO1a in AVA (instead of BFP) and ChR2-HRDC::YFP and jRGECO1a in AIB. HygroR. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|
| MSB1160 |
C. elegans |
mirSi16 II; unc-119(ed3) III. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in flp-18 expressing neurons. Combine with CRE driven by a promoter co-expressed in flp-18 expressing cells to switch from blue expression to ChR2-HRDC and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|
| MSB486 |
C. elegans |
mirSi16 II; eat-4(mir12[loxP 5'UTR] mir17[loxP intron2]) III; mirEx131. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirEx131 [sra-6p::TeNL + npr-9p::ChR2-HRDC::YFP::jRGECO1a + unc-119(+) + gpa:14p::CRE]. Maintain by picking worms with YFP expression in AIB neurons. Blue fluorescence in flp-18 expressing neurons. loxP sites inserrted before first (eat-4(mir12[loxP 5'UTR])) and after second (eat-4(mir17[loxP intron2])) exon of eat-4 gene. Lite. mirEx131 contains calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in ASH and PVQ, ChR2-HRDC::YFP and jRGECO1a expression in AIB and gpa-14p:CRE. CRE under gpa-14 promoter generates a conditional eat-4 KO in ASH (NOT defective) after recombination of loxP sites in that locus and switches BFP expression in AVA to ChR2-HRDC and jRGECO1a after recombination of lox2272 sites. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|
| MSB609 |
C. elegans |
mirSi16 II; eat-4(mir12[loxP 5'UTR] mir17[loxP intron2]) III; mirIs47. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirIs47 [sra-6p::TeNL + npr-9p::ChR2-HRDC::YFP::jRGECO1a + unc-119(+) + gpa:14p::CRE]. Blue fluorescence in flp-18 expressing neurons. loxP sites before first (eat-4(mir12[loxP 5'UTR])) and after second exon (eat-4(mir17[loxP intron2])) of eat-4 gene. Lite. Calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in ASH and PVQ, ChR2-HRDC::YFP and jRGECO1a expression in AIB. Conditional eat-4 KO in ASH (NOT defective) and ChR2-HRDC and jRGECO1a expression in AVA (instead of BFP). Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|
| MSB657 |
C. elegans |
eat-4(mir12[loxP 5'UTR] mir17[loxP intron2]) III; lite-1 (ce314) X. Show Description
loxP sites inserted before first (eat-4(mir12[loxP 5'UTR])) and after second (eat-4(mir17[loxP intron2])) exon of eat-4 gene. Lite. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|
| MSB861 |
C. elegans |
mirSi16 II; mirIs76; mirEx69. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirIs76 [sra-6p::ChRmine::wrmScarlet::let-858 3UTR + sra-6p::TeNL]. mirEx69 [gpa:14p::CRE + unc-122p::mCherry]. Mantain by picking animals with mCherry+ coelomycetes. Blue in flp-18 expressing neurons. Expression of ChRmine, wrmScarlet and calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in ASH and PVQ. Expression of ChR2-HRDC and jRGECO1a expression in AVA (instead of BFP). Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|
| MSB961 |
C. elegans |
mirSi29 II; unc-119(ed3) III. Show Description
mirSi29 [flp-18p::lox2272::mtagBFP2::tbb-2 3'UTR::lox2272::ACR1::SL2::jRGECO1a::let-858 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in flp-18 expressing neurons. Combine with CRE driven by a promoter co-expressed in flp-18 expressing cells to switch from blue expression to ACR1 and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|
| MSB966 |
C. elegans |
mirSi34 II; unc-119(ed3) III. Show Description
mirSi34 [myo-3p::lox2272::mtagBFP2::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::let-858 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in body wall muscles. Combine with CRE driven by a promoter expressed in desired muscle cells to switch from blue expression to ChR2-HRDC and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|
| MSB985 |
C. elegans |
mirSi37 II; unc-119(ed3) III. Show Description
mirSi37 [flp-18p::lox2272::mtagBFP2::tbb-2 3'UTR::lox2272::ChRmine::SL2::jRGECO1a::let-858 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in flp-18 expressing neurons. Combine with CRE driven by a promoter co-expressed in flp-18 expressing cells to switch from blue expression to ChRmine and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|
| NF1796 |
C. elegans |
mig-22(k185) III. Show Description
Long lifespan and healthspan. mig-22(k185) is a gain-of-function allele that increase endogenous chondroitin and suppress the gonad migration defect of mig-17(k174). Reference: Shibata Y, et al. Sci Rep. 2024 Feb 27;14(1):4813. doi: 10.1038/s41598-024-55417-7. PMID: 38413743.
|
|
| NKZ35 |
C. inopinata |
Caenorhabditis inopinata wild isolate Show Description
Caenorhabditis inopinata wild isolate; 10x inbred line. Male-Female. Maintain by mating at 25C or above; does not grow well at 20C. See reference for the details d(https://www.nature.com/articles/s41467-018-05712-5). Sibling species of C. elegans. Inbred 10 times, full genome sequence available. Frozen stock recovery is lower efficiency than C. elegans with glycerol; DMSO method works more efficiently.
Adult: Large and slender species; ca. 1.52.5?mm in length, and individuals may reach up 3.0?mm under optimal culturing conditions. Cuticle is moderate to thick with four-lined lateral field. Deirids on the lateral field, at the level slightly behind the secretoryexcretory pore. Lip separated into six sectors, not clearly offset. Six labial sensilla and four cephalic sensilla present. The anterior end of each lip sector very slightly elongated and forming six stomatal flaps. Amphid small, oval pore-like, at the level of the margin of cheilo and gymnostom. Tube-like stoma separated into three parts; short tube-like cheilostom; simple tube-like gymnostom, which is weakly separated into two subsections; and tube-like stegostom covered by pharyngeal sleeve, which is separated into four subsections, prostegostom, mesostegostom, metastegostom, and telostegostom. Metastegostomatal three teeth flap-like. Pharynx separated into four sections; procorpus forming muscular tube, well-developed metacorpus (median bulb); glandular and narrow isthmus; and basal bulb with double haustrulum as the glottoid apparatus. Pharyngo-intestinal valve (cardia) prominent. Nerve ring around the middle of isthmus. Excretory pore located around the margin of isthmus and basal bulb.
Female: Gonadal system didelphic, amphidelphic. Anterior and posterior gonadal system are basically symmetric with each other, arranged as ovary, oviduct, spermatheca, spermathecal-uterus junction tissue, uterus and vulva/vagina from distal. Sometimes more than 20 developing eggs are deposited. Tail conical or forming slightly elongated conus with pointed tip. Anus and rectum clearly visible; three (two subventral and one dorsal) rectal glands present. Phasmid forming small pore at ca. 60% of total tail length from anus.
Male: Testis single, anteriorly reflexed rightwardly. Vas deferens occupying ca. 1/5 of total gonadal length. Tail enveloped by a closed bursa, supported by nine pairs of bursal rays. Anterior cloacal lip with a rounded and sclerotized appendage and bulge-like appendage between rounded appendage and cloacal opening; a small sensilla-like papilla on the bulge-like appendage. Posterior cloacal lip with tongue-like appendage with two cloacal sensilla. Spicules paired, separate, long and slender with evenly slightly ventrally curved blade and simply pointed tip. Gubernaculum slender, ventrally arcuate with small squared appendage at the distal end in lateral view. Bursa heart-shaped in ventral view, anteriorly closed with serrated edge; serratae obvious in anterior half and vague in posterior half; terminal notch present but unclear. The nine pairs of genital papillae or bursal rays supporting the bursal velum with an arranged (2/1?+?1?+?2?+?3).
|
|
| NM1448 |
C. elegans |
jsIs37 rpm-1(js410) V. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. Superficially wild-type. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope. Reduced SNB-1::GFP localization to synaptic regions; slighty Dpy. js410 has linked phenotype of reduced brood size. js410 is an R->Stop at aa 235. snb-1::GFP is expressed in mechanosensory neurons visible in the cell body and in the axon (very low levels). GFP puncta absent from the ventral nerve cord due to rpm-1 lesion.
|
|
| NYL4291 |
C. elegans |
sqv-5(yad287[sqv-5::GFP]) I. Show Description
GFP tag inserted at C-terminus of endogenous sqv-5 locus. Reference: Wu J, et al. Nat Neurosci. 2025 Jun 18. doi: 10.1038/s41593-025-01989-0. PMID: 40533573.
|
|
| NYL4318 |
C. elegans |
yadIs272. Show Description
yadIs272 [mig-22p::mig-22::GFP + unc-122p::GFP]. mig-22::GFP expression driven by its own promoter. Reference: Wu J, et al. Nat Neurosci. 2025 Jun 18. doi: 10.1038/s41593-025-01989-0. PMID: 40533573.
|
|
| OD3609 |
C elegans |
faah-4(lt121) III. Show Description
NOTE: This strain can be sensitive to starvation; the authors recommend that anyone using this strain for their work should propagate the stock for several generations after starvation before conducting experiments. Reference: Chen AL, et al. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0243-4.
|
|
| OH11319 |
C. elegans |
otIs412 X. Show Description
otIs412 [unc-3p::GFP + rgef-1p::DsRed] X. GFP expression in DA/DB/VA/VB class neurons. Reference: Kerk SY, et al. Neuron 2017 (in press).
|
|
| OH11416 |
C. elegans |
otIs419. Show Description
otIs419 [snb-1p(prom17)::2xNLS::GFP + elt-2::DsRed2]. Ubiquitous GFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
|
|
| OH16380 |
C. elegans |
nlp-45(ot1032[nlp-45::T2A::GFP::H2B]) X. Show Description
Endogenous nlp-45 locus tagged with GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
|
|
| OH16398 |
C. elegans |
otIs763. Show Description
otIs763 [lin-4(fosmid)::NLS::YFP::H2B]. Integrated fosmid transcriptional reporter for lin-4 microRNA. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
|
|