Search Strains

Presumed null allele nlp-45. ot1046 deletion causes a frameshift resulting in a shortened coding sequence that doesn't include mature neuropeptide. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.

Presumed null allele nlp-45. ot1047 deletion causes a frameshift resulting in a shortened coding sequence that doesn't include mature neuropeptide. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.

otIs790 [UPN::npp-9::mCherry::blrp::3xFlag]. otIs790 contains a pan-neuronal INTACT tag for pull-down of all neuronal nuclei. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.

otEx7578 [rab-3p::fem-3::SL2::TagRFP + inx-6(prom18)::TagRFP]. Panneuronal overexpression of fem-3 causes panneuronal masculation. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.

otEx7677 [mgl-1p::nlp-45 cDNA::SL2::TagRFP::p10 3'UTR + inx-6(prom18)::TagRFP]. Pick RFP+ to maintain. Over-expression of nlp-45 in the RMDD/V neurons in nlp-45 mutant background. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.

otEx7681 [glr-3p::nlp-45 cDNA::SL2::TagRFP::p10 3'UTR + inx-6(prom18)::TagRFP]. Pick RFP+ to maintain. Overexpression of nlp-45 in the RIA neurons in nlp-45 mutant background. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.

Endogenous npr-17 locus tagged with GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.

otTi71 [UPN::lin-4::unc-54 3’UTR]. single copy insertion of panneuronally expressed lin-4 pri-miRNA. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.

otIs115 [gcy-12p::GFP]. Integrated promoter fusion reporter for gcy-12. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. References: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2. Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.

otEx7578 [rab-3p::fem-3::SL2::TagRFP + inx-6(prom18)::TagRFP]. Panneuronal overexpression of fem-3 causes panneuronal masculation. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.

wgIs411 [nhr-90::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

wgIs412 [nhr-168::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

wgIs413 [nhr-63::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

wgIs415 [nhr-120::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

wgIs416 [R06F6.6::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

wgIs417 [nhr-124::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

wgIs418 [dmd-4::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

sfGFP tag inserted at C-terminus of endogenous vap-1 locus. VAP-1::sfGFP can be used as a reporter for AMsh glia secretion. Reference: Varandas KC, et al. Nat Commun. 2025 Jan 2;16(1):79. doi: 10.1038/s41467-024-55674-0. PMID: 39747235.

oyIs51 [srh-142::RFP]. ADF neurons are marked with RFP. sfGFP tag inserted at C-terminus of endogenous vap-1 locus. VAP-1::sfGFP can be used as a reporter for AMsh glia secretion. dgs-1(ns942) is a presumptive partial loss of function allele. dgs-1 loss of function causes VAP-1::sfGFP accumulation. Reference: Varandas KC, et al. Nat Commun. 2025 Jan 2;16(1):79. doi: 10.1038/s41467-024-55674-0. PMID: 39747235.

oyIs51 [srh-142::RFP]. ADF neurons are marked with RFP. sfGFP tag inserted at C-terminus of endogenous vap-1 locus. VAP-1::sfGFP can be used as a reporter for AMsh glia secretion. dgs-1 loss of function causes VAP-1::sfGFP accumulation. Reference: Varandas KC, et al. Nat Commun. 2025 Jan 2;16(1):79. doi: 10.1038/s41467-024-55674-0. PMID: 39747235.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. Endogenous osm-6 locus tagged with GFP and AID allows for inducible cilia disruption upon application of auxin. Reference: Varandas KC, et al. Nat Commun. 2025 Jan 2;16(1):79. doi: 10.1038/s41467-024-55674-0. PMID: 39747235.

Endogenous osm-6 locus tagged with AID allows for inducible disruption of cilia in the presence of TIR1 and application of auxin. sfGFP tag inserted at C-terminus of endogenous vap-1 locus. VAP-1::sfGFP can be used as a reporter for AMsh glia secretion. Reference: Varandas KC, et al. Nat Commun. 2025 Jan 2;16(1):79. doi: 10.1038/s41467-024-55674-0. PMID: 39747235.

Endogenous ins-9 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.

Endogenous ins-6 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.

Endogenous nlp-50 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.

Endogenous flp-28 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.

GFP tag inserted at C-terminus of endogenous nhr-49 locus. Reference: Ruiz M, et al. Nat Commun. 2022 Nov 22;13(1):7162. doi: 10.1038/s41467-022-34931-0. PMID: 36418331.

mNeonGreen tag inserted at C-terminus of endogenous bli-2 locus. Superficially wild-type with green fluorescence in L4 epidermis and adult stage cuticle. Reference: Adams JRG, et al. Nat Commun. 2023 Nov 18;14(1):7506. doi: 10.1038/s41467-023-43058-9. PMID: 37980413.

Endogenous flp-14 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.

Endogenous eif-2D locus tagged with GFPnovo2 and 3xFLAG. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821

Endogenous nlp-13 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.

Endogenous eif-2D locus tagged with 3xFLAG. The SUI1 domain of the endogenous EIF-2D locus has been deleted and replaced with 3xFLAG via CRISPR/Cas9 gene editing. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821

Endogenous flp-26 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.

oyIs51 [srh-142::RFP]. ADF neurons are marked with RFP. sfGFP tag inserted at C-terminus of endogenous vap-1 locus. VAP-1::sfGFP can be used as a reporter for AMsh glia secretion. fig-1(syb6983) is an engineered deletion removing teh fig-1 coding sequence. fig-1 loss of function causes VAP-1::sfGFP accumulation and dye filling defects. Reference: Varandas KC, et al. Nat Commun. 2025 Jan 2;16(1):79. doi: 10.1038/s41467-024-55674-0. PMID: 39747235.

sfGFP tag inserted at C-terminus of endogenous fig-1 locus. Reference: Varandas KC, et al. Nat Commun. 2025 Jan 2;16(1):79. doi: 10.1038/s41467-024-55674-0. PMID: 39747235.

utsIs3 [rab-11.2p::YFP::unc-54 3'UTR]. Transcriptional reporter for rab-11.2 activation. YFP expression is low at baseline and activated in the intestine by lipid depletion. Reference: Watterson A, et al. Nature. 2022 May;605(7911):736-740. doi: 10.1038/s41586-022-04729-7. PMID: 35585236.

utsIs4 [nhr-49p::nhr-49::GFP + myo-2p::mCherry]. Strain was back-crossed to N2 following transgene integration (parental strain described in Ratnappan R, et al. PLoS Genet. 2014 Dec 4;10(12):e1004829. doi: 10.1371/journal.pgen.1004829. ). Reference: Watterson A, et al. Nature. 2022 May;605(7911):736-740. doi: 10.1038/s41586-022-04729-7. PMID: 35585236.

kfIs1[plc-1::GFP]. GFP is expressed in the adult hermaphrodite spermatheca.

kfEx2 [plc-1(+) + sur-5::GFP]. Pick GFP+ animals to maintain. plc-1(rx1) homozygotes are semi-Sterile. Animals with the array have normal brood size. Do not distribute this strain; other labs should request it from the CGC.

syIs103[unc-119(+) + pPGF11.13(lin-11::GFP)]. GFP fluoresence is observed in the vulva, uterine pi cells and VC neurons. Do not distribute this strain; other labs should request it from the CGC.

syIs413 [15xUAS::?pes-10::ICE::let-858 3'UTR + unc-122p::GFP + pBlueScript].  Human caspase ICE cGAL effector.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

Homozygous sterile deletion as unbalanced heterozygote. Deletion of 5448 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Pick viable fertile GFP+ animals to maintain. Heterozygotes are wild-type dim GFP+ and segregate wild-type dim GFP+, bright GFP+ sterile adults (ve696 homozygotes), and non-GFP wild-type homozygotes. Left flanking Sequence: cgcataaaggttttccggcatcgaggtctc ; Right flanking sequence: tggaaaaaatgaatctcgagggattttgag. sgRNA #1: accacgattaccgtatctgg; sgRNA #2: GCTGGGATTGTTGACTGTTc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. Note: This allele cannot be balanced by sC4 because it is contained within a deleted region. See Maroilley et al. Sci Reports (2021)11:18258 for more details. doi.org/10.1038/s41598-021-97764-9

Homozygous sterile deletion as an unbalanced het. Deletion of 3148 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type dim GFP+, and segregate wild-type dim GFP+, bright GFP+ adult sterile animals (ve732 homozygotes) and non-GFP wild-type homozygotes. Maintain by picking wild-type dim GFP+. Left flanking Sequence: GCAGGGACTCGGTGCAGATGCTCCAATCAA ; Right flanking sequence: tgggttatttagcccagttttctatttatt. sgRNA #3: AACTGGAAAACTGGCAATTG; sgRNA #4: AGGCACCACAGAGACTTGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. Note: This allele cannot be balanced by sC4 because it is contained within a deleted region. See Maroilley et al. Sci Reports (2021)11:18258 for more details. doi.org/10.1038/s41598-021-97764-9

Homozygous early larval arrest as an unbalanced heterozygote. Deletion of 852 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type dim GFP+, and segregate wild-type dim GFP+, bright GFP+ arrested larvae (ve735 homozygotes) and non-GFP wild-type homozygotes. Maintain by picking wild-type dim GFP+. Left flanking Sequence: tttattagcattttttctagaatgtacacg ; Right flanking sequence: tttttttctgtaaattttttacgaaaatat. sgRNA #3: CGTCACCGATAAGCTATCGT; sgRNA #4: ggtaaactacacgcgtggcc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. Note: This allele cannot be balanced by sC4 because it is contained within a deleted region. See Maroilley et al. Sci Reports (2021)11:18258 for more details. doi.org/10.1038/s41598-021-97764-9

Homozygous Emb as unbalanced heterozygote. Deletion of 3977 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, dead eggs (ve785 homozygotes) and non-GFP wild-type homozygotes. Maintain by picking wild-type GFP+. Left flanking Sequence: TTCGCATTCCGGAAAGCAAAATTCATTTAC ; Right flanking sequence: TGGTTCCTCCACTTAATGGGAGCAAATCCA. sgRNA #1: AACAAGCTTACGGTCTTCCA; sgRNA #2: CAACATCAGCCGCAATGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. Note: This allele cannot be balanced by sC4 because it is contained within a deleted region. See Maroilley et al. Sci Reports (2021)11:18258 for more details. doi.org/10.1038/s41598-021-97764-9

rpIs109 [dpy-7p::NLS::dsRed2 + rol-6(su1006)]. Nuclear red fluorescence in hypodermal cells. Reference: Romanos TR, et al. Sci Rep. 2017 Aug 4;7(1):7294. doi: 10.1038/s41598-017-07876-4. PMID: 28779171.

GFP inserted into endogenous ego-1 locus using CRISPR/CAS9 engineering. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544.

GFP::3xFlag inserted into endogenous drh-3 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544.

GFP::3xFlag inserted into endogenous ekl-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544.

GFP::3xFlag inserted into endogenous elli-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544.