Search Strains

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10485 [ttx-3::TGF(8G1)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. wgIs80 [eor-1::TGF(9G1)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

stIs11395 [C28G1.4::H1-wCherry + unc-119(+)].

stIs11761 [W07G1.3.1::H1-wCherry + unc-119(+)].

Egl, with defects in HSN migration, and HSN and PVQ axon guidance. Crispr/Cas9 induced mutation in Ring1 domain with epigenetic effects on neurodevelopment. Amino acid substitution that likely disrupts interaction with a specific substrate, resulting in a phenotype comparable to a complete gene deletion. Reference: Pierce SB, et al. Proc Natl Acad Sci U S A. 2018 Feb 13;115(7):1558-1563.

Homozygous viable and fertile. No gross behavioral abnormalities. Reduction of thrashing rate and expulsions during defecation cycle. Changed sensitivity to compounds. Increased sensitivity to aldicarb and levamisole in paralysis tests. Reduced sensitivity during egg laying to levamisole, 5-hydrosxytryptamine, and imipramine. Morphological defects in neurite fasciculation, neurite branching, and synapse formation. 1.5bk deletion at the 5' end of the mRNA.

GFP::3xFlag inserted into endogenous egc-3(F59G1.8) locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.

Slow growth, Slow movement. ogr1 is a 1.2 kb deletion causing a frameshift at residue 54 and premature stop at residue 83. Reference: Ogurusu T, et al. Biochem Biophys Res Commun. 2015 Aug 7;463(4):994-8. PMID: 26079877

R11G1.6. External left primer: GAGACGTTGAAGTACGCGCT. External right primer: CCGAAAATTCGAAAGCGTAA. Internal left primer: TTACCCAGAGACCGAACTGC. Internal right primer: CTTCATCGCCCTCTTTCCTT. Internal WT amplicon: 838 bp. Deletion size: approximately 200 bp. This deletion was identified by comparative genome hybridization (CGH) and confirmed by PCR, but was not sequenced. Left flanking probe: AAAGGATCACCCACAGCATCTCTCCAAACAGCCAACCCAAAACTAAAATT. Left deleted probe: AAAACAATGAGTACGGATTCAAAAATAAAACCTTGTAGGAAACTTGTGTA. Right deleted probe: GGATTCGATGGCATCTGTATAGAGTTGAATGGCATAATTATAGGCATTTA. Right flanking probe: GAAGCGATTCGAATCGTTCTCCCGACAACATCTTAGGAACAACGGCCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C17G1.4. Superficially wild type. External left primer: AACGTGTGAGTTCAGTGGGA. External right primer: TGCTTCAGAATTAATGGGGC. Internal left primer: GATTTTCACGCATGTTGCAG. Internal right primer: AATTAATTGGGCGCTTGATG. Internal WT amplicon: 3026 bp. Deletion size: 973 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59G1.3. Small. External left primer: AAAATTCGGGGAATACGACC. External right primer: TTTCCATGGACCTGAACACA. Internal left primer: GATCAGTCGATTCGGGTTGT. Internal right primer: TATTCTGACGGGAAAGGTGG. Internal WT amplicon: 3041 bp. Deletion size: 1590 bp. Deletion left flank: CATTTGGCAACATTAACCGAGTTTTTGAAT. Deletion right flank: CGATCACATTGAAGAGCTTATCGCACGAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T16G1.11. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C07G1.2. External left primer: TCGTGGCAATTGACTGTGAT. External right primer: CGCCGAATATGATGATGATG. Internal left primer: TTTTTGTGAATCTGGAAGAGAATG. Internal right primer: TTACTCACCCAAATCCGAGC. Internal WT amplicon: 1139 bp. Deletion size: 346 bp. Deletion left flank: TTATCCCAATGTTACATTCCACCATGTCCA. Deletion right flank: CTTCTGCTCTAACTAGCTATTTCTATTTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59G1.1. Apparent homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2877 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATTCTGGACAGCGTTTGCTT. External right primer: CCATGATTAAACCAGACGGG. Internal left primer: TCAATCCATTGGGCATTTTT. Internal right primer: GGAATTACCTGCAATGGCTC. Internal WT amplicon: 1331 bp. Deletion size: 689 bp. Deletion left flank: AGATAATAATTTATACGAGAATATAGAATC. Deletion right flank: GGTTTCGTCATTTCTCGATAGAATTTGCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC374.2, F15A4.8, T16G1.9. The allele gk1152 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TTGGAAGTTTTGGCAGGAAT. External right primer: CTTGCGTTAATCGCATGTGT. Internal left primer: TCCAATTTGAGCGATCAGTG. Internal right primer: AGGACGCGCAGATTGTTAGT. Internal WT amplicon: 2448 bp. Deletion size: 842 bp. Deletion left flank: TCAATGTTCTACTTTTTAACGCATTTACGT. Deletion right flank: GGTTTAGAAGATAACTTTAAATGTTTAAAC. The allele gk3032 was identified by CGH but not confirmed by PCR. Left flanking probe: TCCATAATTCTAGCGACGTTGAAGTTTATCTGTGGTTCATGGCCGGAGTA. Right flanking probe: GTCGTAATTCAGAAAGAAACTCTGAAACCATGTGCTGGTTGGATTCCAGC. Left deleted probe: ATCTGTGGTTCATGGCCGGAGTACAGTGGAAGAGGACCAATTAGTGAACT. Right deleted probe: TTGAGATTAGATACTGGGTTTGCAGAGCCTGTCGTAATTCAGAAAGAAAC. The allele gk3033 was identified by CGH but not confirmed by PCR. Left flanking probe: CGAAGCAGGAGGTCACTTGTTTTGCTTTCCGATAATAATTGAATATCTAG. Right flanking probe: GGATAACCAAACATGTTGAAATTGGCCACGGACGCGTAGCATTCTAAAGA. Left deleted probe: GAAACAAAAGGCCAGGCGATAGAAAATAAGGCAGTAAACGTCAATTAATA. Right deleted probe: AATAATTGTTTACCCATTTCTTGTAAATCATGAGGCAATAGTGCTCTGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59G1.5. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3252 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAGTATCTGTCGAAACGCGA. External right primer: CCTGAGAAAATGGGAAGCAA. Internal left primer: CGACGACCAGTTAATGCTGA. Internal right primer: TGATGACGTGGAAGAAGTGC. Internal WT amplicon: 1163 bp. Deletion size: 652 bp. Deletion left flank: GGTCGACGACCAGTTAATGCTGAAAAGAAT. Deletion right flank: TCGTTGTTCATTGTAGTGCTGGAATTGGTA. Insertion Sequence: CG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C17G1.6. External left primer: GGCAGTTTGTCTTTTCACCC. External right primer: CAGAAGACATCGACAGGCAA. Internal left primer: TCTTGTGCTTGATGAGAGGAA. Internal right primer: CGTTCCGAAGGAGATGATGT. Internal WT amplicon: 1326 bp. Deletion size: 484 bp. Deletion left flank: GAATCTTTCTGTTGGTGGATGAACTTCCAA. Deletion right flank: GCTGTATCTGGAGCAACTGTCGTCGTCGGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F55G1.8. External left primer: ACGTCACACGATCTGCACTC. External right primer: ACCGCCAATTATCTACGACG. Internal left primer: TGTTTCTGATATCGTGGCGA. Internal right primer: TACACAATCCAAGTTGCCGA. Internal WT amplicon: 2311 bp. Deletion size: 1122 bp. Deletion left flank: TAAAGATCGAATTATTCACAGATTAGTTGT. Deletion right flank: ATATGTTGGCTCAATCGTAGTCTTGAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C54D1.1, F55G1.5. The gk1250 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: GCACGTTGCGAAGTAGATGA. External right primer: GCGGTACAACGATTGAAGGT. Internal left primer: TCGTTGCCTGTTGTATGGAA. Internal right primer: CCGATGAAATGGCAAAATCT. Internal WT amplicon: 1387 bp. Deletion size: 621 bp. Deletion left flank: AGTCGTAATCACCACACCAATGGAGCTATT. Deletion right flank: TGCGTCGGTTTCGCCTAGAGCATTTATTTT. The gk3148 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C07G1.5. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous ok579 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3164) in W07G1.3, detectable by PCR using the following primers. External left primer: CAGGCTGATCCATTACGGTT. External right primer: TTCCCTGTCTCCAAAAATGC. Internal left primer: CGTATCAACTGGAATCGGGT. Internal right primer: GCTCCGAGCTCTCCCTATTT. Internal WT amplicon: 2525 bp. Deletion size: 1275 bp. Deletion left flank: AGTGTTTCAATTCGGCTTGATCTACGTAGA. Deletion right flank: ATGAATAGACCACGACCATTTTCTGGGCGG. Validation: gk3164 passed by CGH. Other deletions (gk3267, gkDf41) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59G1.7, F59G1.1. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and ok610 homozygotes (viable GFP- adult, sometimes slow-growing with various occasional body defects). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 1769 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACTACAATAGAGTTCCACTAACGCCAACT; Right flanking sequence: TTTGGTAATTTGCCAAAATTCGACGGTCAT. See WormBase Variation gk5058 for details.

Homozygous viable. Deletion of 3831 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: AATGTGTCAAATTTTCAGATCTGATGATTT. Right flanking sequence: GGGTTAAAGTCTCTCCATCTCGATCAGATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

C07G1.3a. Superficially wild type; low penetrance Unc with everted gonad. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

agIs219 [T24B8.5p::GFP::unc-54-3' UTR + ttx-3p::GFP::unc-54-3' UTR] III. T16G1.11 Increased lifespan and enhanced resistance to endoplasmic reticulum (ER) stress, independent of IRE-1-XBP-1, ATF-6, and PEK-1. Reference: Cattie DJ, et al. PLoS Genet. 2016 Sep 30;12(9):e1006326.

See WBG 7(1) 48. Isolated from soil in Ahmedabad, India. Previously called C. briggsae G16. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Heterozygotes are WT and segregate WT, UncBli, and Steriles which have an everted vulva. ar104 previously called evl-22 and mat-2.

Heterozygotes are WT and segregate WT, DpyUncs and adult steriles. Original deletion from Axys Pharmaceuticals.

Unc and Dpy. Not Blistered: dpy-10 suppresses the appearance of the blisters.

Unc. Reduced brood size. Larval lethal, larval arrest. Steriles. Bursts at vulva. Can be maintained as a homozygote.

Reduced brood size. Reduced hatching. Slow growth. Larval lethal. Larval arrest. Bursts at vulva. Suppresses the mat-3 one-cell arrest at 25C.

Unc. Gain-of-function allele of fzy-1.

Unc. Previously called AG164 by the CGC.

avEx122 [(pAG126) lpin-1p::GFP::lpin-1::lpin-1 3'UTR + unc-119(+)]. No GFP expression detected in germline.

avEx123 [lpin-1p::GFP::his-58::lpin-1 3'UTR + unc-119(+)]. No GFP expression detected in germline.

Enhanced pathogen resistance.

sEx10173 [rCes C17G10.9a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx10255 [rCesC23G10.4b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx10594 [rCesF35G12.3B::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx10634 [rCes Y39G10AR.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx10753 [rCes Y57G11C.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx10754 [rCes C09G12.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx10981 [rCes Y71G12B.16::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx11322 [rCes T25G12.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx11504 [rCesY8G1A.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx11855 [rCes C17G10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx12078 [rCes T08G11.1b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx12103 contains [rCes F42G10.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx12145 [rCes Y45G12C.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).