| CER660 |
C. elegans |
cer227[mex-5p::SpG(smu-2 introns) + unc-119(+)] II; unc-119(ed3) III. Show Description
Missense mutations D1135L and S1136W, G1218K and E1219Q, and R1335Q and T1337R were introduced on the Cas9 gene at EG9615 strain, to cause endogenous expression of the Cas9 variant SpG. SpG is efficient for CRISPR on NGN PAM sites. Reference: Vicencio J, et al. Nature Communication, 2022. May 12;13(1):2601. doi: 10.1038/s41467-022-30228-4.
|
|
| CF301 |
C. elegans |
mab-5(e2088) III; unc-31(e169) IV; him-5(e1490) V; muIs9 X. Show Description
muIs9 [hs-mab-5 + C14G10]. Heat-shock inducible mab-5. C14G10 contains a WT copy of unc-31. muIs9 integrated by gamma irradiation.
|
|
| CG118 |
C. elegans |
unc-43(sy574) IV; him-5(e1490) V. Show Description
Males constitutively protract their spicules in the absence of mating cues.
|
|
| CG1367 |
C.elegans |
pck-2(rg551[pck-2::YFP]) I; him-5(e1490) V. Show Description
rg551 is an endogenous genomic CRISPR/Cas9 knock in of YFP fused to the C-terminus of the gene pck-2 in N2 background. Robust YFP fluorescence body wall muscle, intestine, hypodermis and pharyngeal muscle. Him. Reference: Goncalves J, et al. iScience 2020 Mar 19;23(4):100990. PMID: 32240955
|
|
| CG1428 |
C. elegans |
tmc-1(rg1003) X. Show Description
rg1003 promotes development and male mating behavior on a chemically defined C. elegans maintenance medium (CeMM). Reference: Zhang L, et al. Nature Communications (2015) In press.
|
|
| CG1438 |
C. elegans |
egl-2(rg444) him-5(e1490) V. Show Description
rg444 is an endogenous genomic CRISPR/Cas9 knock in of YFP fused to the C-terminus of the EGL-2 K+ Channel in N2 background. Faint YFP fluorescent puncta can be detected on muscle membranes and neural cell bodies and processes at high power magnification in all stages. Him. Reference: Goncalves J, et al. iScience 2020 Mar 19;23(4):100990. PMID: 32240955
|
|
| CG197 |
C. elegans |
egl-2(rg4) him-5(e1490) V. Show Description
No longer able to suppress male muscle seizures in the absence of food.
|
|
| CGC2 |
C. briggsae |
C. briggsae wild isolate. Show Description
C. briggsae reference strain formerly known as PB420. Derived from C. briggsae Gujarat, the strain that later was named G16 and then AF16. PB420 was frozen (as C. briggsae Gujarat) 22 March 1991, thawed 15 June 2020 and sent to the CGC 1 July 2020. It may be considered ancestral to AF16 and was renamed to distinguish it from AF16 strains that have been maintained in laboratory cultures. Reference: Fodor A, et al. Nematologica 1983 92: 203-217. doi:10/1163.187529283X00456. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| CH116 |
C. elegans |
hsb-1(cg116) IV. Show Description
Viable and fertile. Deletion of 664 bp, molecular null.
|
|
| CH118 |
C. elegans |
nid-1(cg118) V. Show Description
Parental strain was CH1416 mut-2(r459) I; nid-1(ev608) V. Tc1 excision deletion of nid-1 was identified. In frame deletion, removes amino acids Thr53-Gln693 of NID-1. Homozygous viable and fertile, slightly reduced fertility. mut-2 was removed by outcrossing. nid-1=F54F3.1. Received new stock 1/2004 from Jim Kramer.
|
|
| CH119 |
C. elegans |
nid-1(cg119) V. Show Description
Parental strain was CH1416 mut-2(r459) I; nid-1(ev608) V. Tc1 excision deletion of nid-1 was identified. Molecular null, deletion removes promoter region. Homozygous viable and fertile, fecundity reduced by approximately 30%. nid-1=F54F3.1.
|
|
| CH120 |
C. elegans |
cle-1(cg120) I. Show Description
Homozygous viable and fertile. Partially penetrant Egl and cell/axon guidance defects. Deletion of nucleotides 22756-24758 based on cosmid F39H11 sequence (Genbank AF164959). Results in loss of carboxyl NC1 domain from CLE-1.
|
|
| CH121 |
C. elegans |
dgn-1(cg121)/dpy-6(e14) unc-115(mn481) X. Show Description
Heterozygotes are WT and segregate WT, DpyUncs, and Ste (and Gon) cg121 homozygotes.
|
|
| CH1315 |
C. elegans |
zmp-1(cg115) III. Show Description
Superficially wild-type. 2366 bp deletion (965-3330 of U41266(EGAP1)) caused by imprecise excision of Tc1. Deletion can be detected by PCR with primers DSP4 (AATTAGTTGACGAGACAAGTCAGG) and B3 (AGTGAAGGCAGAATGTACTCC) --306 kb WT vs 1.2 kb mutant.
|
|
| CH1869 |
C. elegans |
dgn-1(cg121) X; cgEx308. Show Description
cgEx308 [dgn-1(+) + dng-1p::GFP + rol-6(su1006)]. Rollers. Pick rollers to maintain. Segregates sterile non-rollers (dgn-1 homozygotes) and fertile rollers (dgn-1 rescued). Rollers can be used to produce cg121/o; cgEx308 males that can mate.
|
|
| CH1878 |
C. elegans |
dgn-2(ok209) dgn-3(tm1092) dgn-1(cg121) X; cgEx308. Show Description
cgEx308 [pJK600/dgn-1(+) + pJK602/dng-1p::GFP + rol-6(su1066)]. Rollers. Pick rollers to maintain. Segregates sterile non-rollers (dgn-2 dgn-3 dgn-1 homozygotes) and fertile rollers (dgn-1 rescued). Rollers can be used to produce cg121/o; cgEx308 males that can mate. Triple mutants resemble dgn-1 single mutants; no overt phenotype caused by dgn-2 dgn-3 mutations.
|
|
| CHS1114 |
C. elegans |
srw-108(yum1674) V; srw-111(yum1675) I; srw-112(yum1676) srw-113(yum1677) V; m01g12.6(yum1678) m01g12.16(yum2916) I. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1209 |
C. elegans |
f57g9.7(yum2254) r05f9.7(yum2255) c54c6.4(yum2256) r11g10.3(yum2257) f27e5.5(yum2258) f27e5.8(yum2259) t10g3.2(yum2260) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1222 |
C. elegans |
f27e5.8(yum2341) t10g3.4(yum2342) t10g3.2(yum2343) y57g11c.46(yum2344) y57g11c.28(yum2345) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1238 |
C. elegans |
f07b10.4(yum2454) f07b10.7(yum2455) f59b1.6(yum2456) zk418.7(yum2457) w08g11.5(yum2458) r10e8.5(yum2459) zk418.6(yum2460) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1254 |
C. elegans |
str-119(yum2582) str-121(yum2583) y45g12c.10(yum2585) str-120(yum2586) y45g12c.6(yum2587) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1262 |
C. elegans |
srt-42(yum2647) srt-43(yum2648) srt-44(yum2649) srt-45(yum2650) srt-47(yum2651) srt-48(yum2652) srt-49(yum2653) srt-50(yum2654) srt-52(yum2655) srt-53(yum2656) y57g11c.28(yum2657) y57g11c.30(yum2658) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1592 |
C. elegans |
h20j04.7(yum2844) k03h6.4(yum2845) r13h4.7(yum2846) c34b4.3(yum2847) t23b3.6(yum2848) y26g10.1(yum2849) y26g10.4(yum2850) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CSG10 |
C. elegans |
gsgIs1 IV. Show Description
gsgIs1 [synthetic 900 bp HA1 left::dpy-10 cRNA site:: synthetic 900 bp HA2 right] (IV: 5014948). Superficially wild-type. gsgIs1 can be used to generate single-copy insertions in C. elegans Chromosome IV. This strain is part of the SKI PLACE System, which can be used to generate single-copy insertions into the C. elegans genome at specific safe harbor locations on each chromosome through CRISPR-Cas9-mediated insertion. The system uses a single plasmid, pSKI (Addgene #232484), to insert transgenes at specific genomic locations. Generated in N2 background. Reference: Dinneen E, et al. G3 (Bethesda). 2025 Sep 19:jkaf220. doi: 10.1093/g3journal/jkaf220. PMID: 40973646.
|
|
| CSG18 |
C. elegans |
gsgIs2 I. Show Description
gsgIs2 [synthetic 900 bp HA1 left::dpy-10 cRNA site:: synthetic 900 bp HA2 right] (I: 2850968). Superficially wild-type. sgIs2 can be used to generate single-copy insertions in C. elegans Chromosome I. This strain is part of the SKI PLACE System, which can be used to generate single-copy insertions into the C. elegans genome at specific safe harbor locations on each chromosome through CRISPR-Cas9-mediated insertion. The system uses a single plasmid, pSKI (Addgene #232484), to insert transgenes at specific genomic locations. Generated in N2 background. Reference: Dinneen E, et al. G3 (Bethesda). 2025 Sep 19:jkaf220. doi: 10.1093/g3journal/jkaf220. PMID: 40973646.
|
|
| CY397 |
C. elegans |
daf-16(mg242) I; sqt-1(sc13) age-1(mg109) II. Show Description
Sqt phenotype. The daf-16(mg242) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg242 is a nonsense mutation Trp220Amb.
|
|
| CY398 |
C. elegans |
daf-16(mg255) I; sqt-1(sc13) age-1(mg109) II. Show Description
Sqt phenotype. The daf-16(mg255) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg255 is a nonsense mutation Try144Amb.
|
|
| CY399 |
C. elegans |
sqt-1(sc13) age-1(mg109) II; pdk-1(mg261) X. Show Description
Sqt phenotype. The pdk-1(mg261) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg261 is an activating missense mutation Ala447Val.
|
|
| CY400 |
C. elegans |
sqt-1(sc13) age-1(mg109) II; akt-1(mg247) V. Show Description
Sqt phenotype. The akt-1(mg247) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg247 is an activating missense mutation Ala149Thr.
|
|
| CY401 |
C. elegans |
sqt-1(sc13) age-1(mg109)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Sqt. age-1(mg109) homozygotes throw all dauers at all temperatures (maternal effect dauer constitutive). age-1(mg109) homozygous animals that are maternally rescued for dauer formation are long-lived.
|
|
| CYA13 |
C. elegans |
frSi17 II; rde-1(ne300) V; ldrIs1. Show Description
frSi17 [mtl- 2p::rde-1 3'UTR] II. ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. RDE-1 activity is rescued in the intestine, making animals RNAi-deficient except for intestinal tissues. Derived by crossing parental strains IG1839 and LIU1. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets. frSi17 inserted into ttTi5605 site.
|
|
| CZ4601 |
C. elegans |
syd-2(ju487) X. Show Description
ju487 is a gain-of-function allele of syd-2, changing Arg184 to Cys. Reference: Dai Y, et al. Nat Neurosci. 2006 Dec;9(12):1479-87. doi: 10.1038/nn1808. PMID: 17115037.
|
|
| DAG355 |
C. elegans |
lite?1(ce314) X; domIs355. Show Description
domIs355 [mec?3p::QF + mec?4p::QS + QUAS::CoChR::GFP + unc122p::RFP]. High sensitivity blue-light optogenetic line for FLP neurons. Transgenic animals expressing the high-sensitivity blue light-activated channelrhodopsin CoChR into FLP using the Q-system combining mec-3p and mec-4p promoters. In animals grown on all trans-retinal-containing medium, low intensity blue light stimuli trigger reversal responses. Animals have red coelomocytes. The transgene was integrated with UV, and outcrossed 2x to parental ce314 mutant strain KG1180. Reference: Schild LC & Glauser DA. Genetics. 2015 Aug;200(4):1029-34. doi: 10.1534/genetics.115.177956. PMID: 26022242.
|
|
| DF5173 |
C. sp. 8 |
Show Description
Male-female strain. 20x inbred line derived from TMG13. Heat shock 2.5-3.0 hrs at 30C immediately prior to freezing.
|
|
| DG1255 |
C. elegans |
unc-53(e404) sqt-1(e1350) II. Show Description
e1350 is a recessive Dpy, dominant Roller. Unc.
|
|
| DG1575 |
C. elegans |
tnIs6. Show Description
tnIs6 [lim-7::GFP + rol-6(su1006)]. Rollers. lim-7::GFP is expressed in sheath cells (see Hall et al., 1999, Developmental Biology 212: 101-123. Insertion site not mapped.
|
|
| DG1576 |
C. elegans |
tnIs5. Show Description
tnIs5 [lim-7::GFP + rol-6(su1006)]. Rollers. lim-7::GFP is expressed in sheath cells (see Hall et al., 1999, Developmental Biology 212: 101-123. Insertion site not mapped.
|
|
| DG1604 |
C. elegans |
fog-2(q71) V; ceh-18(mg57) X. Show Description
Maintain by mating females with males.
|
|
| DG1612 |
C. elegans |
vab-1(dx31)/mIn1 [dpy-10(e128) mIs14] II; fog-2(q71) V. Show Description
Maintain by mating GFP+ females with GFP+ males.
|
|
| DG1650 |
C. elegans |
vab-1(dx31)/mIn1 [dpy-10(e128) mIs14] II; fog-2(q71) V; ceh-18(mg57) X. Show Description
Maintain by mating GFP+ females with GFP+ males.
|
|
| DG1701 |
C. elegans |
cgh-1(tn691) III. Show Description
Semi-dominant temperature-sensitive embryonic lethal. Maintain at 15C.
|
|
| DG1770 |
C. elegans |
cgh-1(ok492) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C07H6.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok492 homozygotes (sterile adult, tends to explode at vulva). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCAGCTCGAAAATATTGCC. External right primer: GGAAAACCGCAAGGATGGTGG. Internal left primer: TCACGGAGCTAGATGTGACG. Internal right primer: CGTCAAAAAGAACCCGATGT. Internal WT amplicon: 3095 bp. Deletion size: 1043 bp. Deletion left flank: GAGAACATACACAATCTGGACGAGATCACT. Deletion right flank: CCTGGGGTGGCGATGACCAAGTGAACCGTT. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.
|
|
| DG1856 |
C. elegans |
goa-1(sa734) I. Show Description
Recessive, early stop mutation within the coding sequence (C to T substitution in aa52) makes sa734 a likely null allele. May grow slightly better at 15C. Hyperactive, lays early stage eggs, increased amplitude of locomotory wave-form. Suppresses the lethargy and egg-laying defects of unc-43(n498). Reverses direction of locomotion more frequently than WT.
|
|
| DG1867 |
C. elegans |
glp-1(tn777) III. Show Description
Temperature sensitive. Maintain at 15C.
|
|
| DM7134 |
C. elegans |
pha-1(e2123) III; raEx134. Show Description
raEx134 [T05G5.1p::Y48G10A.3(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
| DM7192 |
C. elegans |
pha-1(e2123) III; raEx192. Show Description
raEx192 [T05G5.1p::Y54G11A.11(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
| DM7300 |
C. elegans |
pha-1(e2123) III; raEx300. Show Description
raEx300 [T05G5.1p::W05G11.6(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
| DM7307 |
C. elegans |
pha-1(e2123) III; raEx307. Show Description
raEx307 [T05G5.1p::Y57G11C.3(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
| DQ3188 |
C. elegans |
unc-11(vg103[unc-11::GFP]) I. Show Description
Superficially wild-type. Endogenously-tagged UNC-11::GFP is expressed in most, if not all, neurons, epithelial cells and coelomocytes, and should be visible in the nerve ring through a dissecting scope..
|
|
| DV3313 |
C. elegans |
rap-1(re180) IV. Show Description
Gain-of-function allele (G12V). Low penetrance of 3? to 1? fate transformations (Muv) and duplication of the excretory duct cell. Genotyping primers (Tm=50C, followed by BamHI digestion): oNR122: TGTGTCATCTGGTCTGTACTTGG; oNR123: TCCCCTGCACGAATTGTACC. Reference: Rasmussen NR, Dickinson DJ, and Reiner DJ. Genetics Dec;210(4):1339-1354. doi: 10.1534/genetics.118.301601. PMID: 30257933.
|
|