Search Strains

Previously called C. briggsae Zuckerman. This stock was maintained in liquid culture for some number of years and carrues a 33-kilobase deletion that disrupts one of the srg paralogs, CBG24690, and six other genes. It is Unc, dauer-defective and ts lethal. Reference: McGrath PT, et al. Nature. 2011 Aug 17;477(7364):321-5.

This strain forms 20% dauers at 15C. At 25C there occurs about 25% embryonic arrest and about 75% L1 arrest. The e979 mutation results in an amino acid substitution, C146Y, in the ligand-binding domain of the DAF-2 receptor. [CGC received new stock of DR1942 September 2002. Previous stock was probably m41 and not e979.] [June 2004: Patrice Albert has confirmed the mutation in this stock: Repeat of sequencing for CGC collection strain DR1942 [daf-2(e979)] is complete. The strain does carry a C146Y mutation (coding strand TGC to TAC) [Mutation position is at 143, not 146, based on the amino acid sequence shown in Wormbase for daf-2. It's the C in partial sequence EKRCGPI of Exon 5.].]

Heterozygotes are WT and segregate WT, Lethal Rollers (arrested 2-fold hatchlings), and Unc-4 mIn1(mC6) homozygotes. Pick WT and check for correct segregation of progeny.

Dpy. Segregates males. Semi-dominant Roller.

Forms dauer larvae non-conditionally but only arrests at dauer stage for 1-2 days, then grows to adult. daf-c but not ts - can grow at 15C or 20C.

Dauer defective. Class 2 suppressor of dauer constitutives. Chemotaxis normal. See also WBPaper00002149. [Previously called daf-20.]

Temperature sensitive Dpy. Penetrance is incomplete. Left hand roller. Roller low penetrance. Maternal sterile at 25C.

daf-d. Weak heterochronic phenotypes in seam, somatic gonad, intestine. Class III allele.

RollerUnc.

Temperature sensitive Daf-c. Maintain at 15C. Adults Age and Itt, but not Unc (severe class 1 allele). m212 results in an amino acid substitution(C883Y) in the extracellular portion of the DAF-2 receptor (specificaly, the FnIII2ID domain).

Temperature sensitive. Sensitive to alpha-amanitin. Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, dead embryos, and Dpy. Dpy progeny arrest in mid-larval stages at >20C. Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.

Dpy. Sensitive to alpha-amanitin. Temperature sensitive, maintain at 15C. Fertile at 20C. Emb at restricitve temperature (25C). Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.

Dpy. Sensitive to alpha-amanitin. Temperature sensitive, maintain at 15C. Fertile at 20C. Emb at restrictive temperature (25C). Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.

Sensitive to alpha-amanitin. Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, dead embryos, and Dpy. Dpy progeny arrest in L1 stage at >20C. Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.

Sensitive to alpha-amanitin. Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, dead embryos, and Dpy. Dpy progeny arrest in L1 stage at >20C. Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.

Sensitive to alpha-amanitin. Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, dead embryos, and Dpy. Dpy progeny arrest in L1 stage at >20C. Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.

Temperature sensitive. Sensitive to alpha-amanitin. Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, dead embryos, and Dpy. Dpy progeny are maternal effect Emb at 20C and arrest in mid-larval stages at 25C. Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.

Dpy. Sensitive to alpha-amanitin. [NOTE: formerly described as ama-1(m118m370m414), it has been determined that m414 was reversion of m367 back to wild-type sequence.] Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.

Dpy. Sensitive to alpha-amanitin. Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.

daf-d. Weak heterochronic phenotypes in seam, somatic gonad, and intestine. Class III allele.

daf-d. Weak heterochronic phenotypes in intestine. Class III allele.

daf-d. Weak heterochronic phenotypes in seam, somatic gonad, intestine. Class III allele.

daf-d. Weak heterochronic phenotypes in seam, somatic gonad, intestine. Class III allele.

daf-d. Weak heterochronic phenotypes in intestine. Class III allele.

Green nuclei and ubiquitous cytosolic red expression, typically excluded from nuclei but with activity-dependent translocation into nuclei. Derived in an N2 background. C-terminally tagged mpk-1 is detectable by triplex PCR: mpk-1 genotyping FW: ACCAAAACAACCATGGGCTCG mpk-1 genotyping RV-1: GCTCCAAGTATGGGTGAGCC mpk-1 genotyping RV-2: GGTTCCCTCGTATGGCTTTCC Reference: Neal R, et al. (2021). Nuclear translocation of tagged endogenous ERK/MPK-1 MAP Kinase denotes a subset of activation events in C. elegans development.

tm1086 is homozygous lethal. Maternally rescued. Fails to produce viable progeny due to a defect in repairing meiotic DNA double-strand breaks. Chromosomes are visibly aggregated at diakinesis. Maintain by picking GFP progeny and checking that the non-GFP progeny that are produced fail to give viable progeny. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.

Originally from ecological study at University of GA. Identification by E. Mae Noffsinger.

Mentioned in Soil Biol. Biochem 25(9): 1141-1151, 1993. Sent to DWF from E.M. Noffsinger. Isolated in CA.

Isolated in Fort Collins, CO. Species identification done by Lynn Carta.

Originally from UCR collection. Identification by E. Mae Noffsinger.

Isolated in Fort Collins, CO. Species identification done by Lynn Carta.

Superficially wild-type. ups39 is a CRISPR-engineered deletion within daam-1. daam-1(ups39) encodes an in-frame stop codon near the start of its FH2-coding sequence, and a 1-nt frame shift due to the LoxP site, and is thus predicted encode a non-functional formin. Reference: Sundaramurthy S, et al. Cytoskeleton (Hoboken). 2020 Oct;77(10):422-441. doi: 10.1002/cm.21639. PMID: 33103378.

syIs80 [(pPGF11.13) lin-11::GFP + unc-119(+)] III. Animals are Unc. GFP fluorescence is observed in vulval cells, uterine pi cells and VC neurons.

ezIs1[K09C8.2::GFP + rol-6(su1006)]. ezIs1 was integrated with pPD95.65(K09C8.2 promoter and unc-54 3') and pRF4. Worms are 100% Rollers. GFP is expressed in male seminal vesicle and vas deferens cells. No expression in the hermaphrodite gonad is observed.

ezIs2 [fkh-6::GFP + unc-119(+)]. ezIs2 was integrated with pPD95.69 (fkh-6 promoter and unc-54 3') and pMM106b (unc-119(+)). Worms are 100% non-Unc (the unc-119 background has been crossed out). GFP expression in adult hermaphrodite spermatheca is bright and weak staining is also observed in the proximal sheath cells. Weak GFP staining is also observed in Z1/Z4 cells in both sexes.

Caenorhabditis elegans wild isolate. Isolated from a compost bin from a West Mains allotment public vegetable garden near Edinburgh Scotland on Dec. 19, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): J. Reference: Andersen EC, et al. Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Nov. 26, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): A. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Nov. 26, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): J. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Dec. 3, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): A. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Dec. 19, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): N. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Dec. 3, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): J. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 2 plot 43) near Edinburgh Scotland on Dec. 19, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): A. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

upIs1 [mup-4::GFP + rol-6(su1006)]. Rollers. [NOTE: 11/2006: Pamela Hoppe determined that the strain is homozygous for mup-4.]

Dpy suppresses Bli and Lon. Strain appears to be only slightly Dpy. Useful for mapping, especially Unc mutations. Separately, dpy-11 causes dumpiness, bli-6 adult worms develop blisters on their bodies, and lon-2 worms are about 150% WT length.

At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Nucleotide change: substitution [c/t]. Flanking sequences: TTGTGGAGGATGCGGAACTAAAACC[c/t]GAGTTAGAGCATGCTACGGTGGAAA.

At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Deletion. Flanking sequences: ttcttgtccagtagggtctagtcgtggttg tgaacttgcctgtcgatgtcttctggctga.

Abnormal posterior body muscle contractions during defecation. Derived by single outcrossing of MT1733; allelic to n2303.

Isolated by Michael Ailion from rotting apricot from home of Wayne Davis and Danielle Endres in Salt Lake City, Utah, 8/4/2006, under tree on north side of house. Coordinates: 40° 42' 26.16" N, 111° 52' 3.27" W. Animals move very rapidly. Strain started from a single L4 hermaphrodite and grown three generations before freezing. 18S rDNA sequence differs from C. briggsae NCBI entry (PB102), but is identical to the 18S sequence of AF16, HK104, PB800 and VT847. Cross-fertile with AF16. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Unc. Not caused by ttTi5605. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat). [NOTE: 11/15/11 - This strain contains unc-119(ed9), not unc-119(ed3) as previously reported. (C. Frokjaer-Jensen)] [NOTE: The Dernburg lab has noticed an increased number of rad-51 foci in EG4322 compared to N2. Please use the outcrossed version of this strain (EG6699) instead, which does not have this problem. (C. Frokjaer-Jensen)]

Utah natural isolate carrying peel-1(qq99) I. EG4348 was collected by M. Ailion from Salt Lake City, UT. qq99 designates the naturally occurring nonsense mutation in peel-1. Reference: Seidel HS et al. PLoS Biol. 2011 Jul;9(7):e1001115. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).