Strain Information
| Name | EG199 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | nas-37(ox199) X. |
| Description | At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Nucleotide change: substitution [c/t]. Flanking sequences: TTGTGGAGGATGCGGAACTAAAACC[c/t]GAGTTAGAGCATGCTACGGTGGAAA. |
| Mutagen | ENU |
| Outcrossed | x2 |
| Made by | Wayne Davis |
| Laboratory | EG |
Sign in
or
register an account if you want to order this strain.