Search Strains

dvIs19 [gst-4p::GFP::NLS] III. rexEx11 [hsp-16p::halo::TEV::Keap1 + mec-7p::mRFP]. Pick RFP+ worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces expression of Halo::TEV::Keap1 protein. Oxidative stress induces expression of GFP. Superficially wild-type.

ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. cyp-33E1(syb8800) is Cys295 mutated to Ala. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets. Derived by crossing syb8800 with LIU1 and out-crossing with N2.

Inversion which may serve as a balancer for the center of LG V. Maternal effect lethal allele which results in 57% embryonic arrest, 40% larval arrest, and 3% which survive to be fertile adults with a variety of defects including Egl, Unc and Vab.

juIs319 [col-19p::GCaMP3 + col-19p::tdTomato]. col-19p::GCaMP3 expression is induced by either laser or needle wounding. col-19 is an adult-specific collagen and is not expressed until the end of the L4 larval stage. Reference: Xu S & Chisholm AD. Curr Biol. 2011 Dec 6;21(23):1960-7.

juIs109 [efn-4::GFP + lin-15(+)] X. Superficailly wild-type. GFP expression detected under high power in a subset of head neurons, primary vulval cells, and a pair of pharyngeal neurons. Reference: Chin-Sang ID, et al. Development. 2002 Dec;129(23):5499-510.

juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. Superficially wild-type. No fluorescence; carries only one portion of a split GFP reporter for visualization of ribosomes. Allows inducible GFP fluorescence of ribosomes when combined with GFP1-10 expression in tissue of choice. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.

juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5377 [myo-3p::GFP1-10 + ttx-3p::RFP]. Pick ttx-3::RFP to maintain. Muscle-specific expression of split GFP reporter allows visualization of ribosomes in muscle. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.

juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5515 [unc-25p::GFP1-10 + unc-25p::mCherry::rab-3 + ttx-3p::RFP]. Pick ttx-3::RFP to maintain. GABAergic motor neuron-specific expression of split GFP reporter allows visualization of ribosomes in neurons, and GABAergic motor neuron-specific expression of mCherry::rab-3. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.

juSi123 [rpl-29::GFP] II. Strong GFP signal allowing visualization of ribosomes. GFP inserted at C-terminus of RPL-29. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.

juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juIs409 [rgef-1p::GFP1-10 + ttx-3p::RFP] IV. Pan-neuronal-specific expression of split GFP reporter allows visualization of ribosomes in neurons. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.

juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juIs463 [flp-13p::GFP1-10 + ttx-3p::RFP]. DD motor neuron-specific expression of split GFP reporter allows visualization of ribosomes in those neurons. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.

Gain-of-function allele isolated sem-4; juIs1 screen in 1997. ju89 has slightly semi-dominant effects, and the gf phenotype is most obvious in homozygous. This outcrossed strain does not carry a sem-4 mutation or juIs1. References: Kurup N, et al. Curr Biol. 2015 Jun 15;25(12):1594-605. Kurup N, et al. PLoS Genet. 2017 Jun 21;13(6):e1006844.

juSi271 [col-19p::mito::Dendra2]. Superficially wild-type with altered mitochondrial morphology. Fluorescent reporter labels hypodermal mitochondria. Reference: Xu S, et al. J Genet Genomics. 2016 Feb 20;43(2):103-6.

Aldicarb resistant. Reference: McCulloch KA, et al. G3 (Bethesda). 2017 Jul 5;7(7):2055-2063.

unc-44(ju1413[unc-44::GFP::LoxP::3xflag]) IV. UNC-44C (short isoform of UNC-44) tagged with GFP. UNC-44C is strongly expressed in multiple tissues: nervous system (from 1.5-fold stage to adult), epidermis (from early embryo to adult), seam cells (from L1 to L4), vulva (from L3 to adult), and spermatheca/sheath cells (from L4 to adult). Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707.

CRISPR-engineered deletion of esyt-2 from middle of 5'UTR to middle of 3'UTR using guide RNAs crCP01 (GGTTTCAGTAATTGTGGGCT) and crCP02 (GTGCACTTACGGGTTGTAGG). Superficially wild-type. Reference: Piggott CA, et al. Genetics. 2021 Apr 19;iyab063. doi: 10.1093/genetics/iyab063. PMID: 33871019.

Superficially wild type with green fluorescence in L4 epidermis and adult stage cuticle. mNeonGreen and 3xFLAG tags inserted in N-terminus of endogenous BLI-1 locus at A106 (after subtilisin cleavage site) using Dickinson method. Reference: Adams JRG, et al. Nat Commun. 2023 Nov 18;14(1):7506. doi: 10.1038/s41467-023-43058-9. PMID: 37980413.

mNeonGreen tag inserted at C-terminus of endogenous bli-6 locus using Dickinson method. Superficially wild-type with green fluorescence in L4 epidermis and adult stage cuticle. Reference: Adams JRG, et al. Nat Commun. 2023 Nov 18;14(1):7506. doi: 10.1038/s41467-023-43058-9. PMID: 37980413.

juIs167 [vab-19::GFP + rol-6(su1006)]. Integrated by UV/TMP. Rollers. Received new stock Feb 2005.

juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. GFP expression in presynaptic terminals of GABAergic DD and VD motor neurons and RME neurons. Maintain under normal conditions. Reference: Hallan SJ and Jin Y. Nature. 1998 Sep 3;395(6697):78-82.

2505bp deletion in cosmid T07D1. Break points are 6562 and 9069 with respect to T07D1. Sequence at the break point is: GGAAAAAAAAACTTCGCG / TTTGGCTAGTCGTAT. Primers: ok296u1: CTGAAACCATCTGACAGA; ok296d1: CATCGGAATAGGATTGTTG; ok296d2: CATTAGGTTTACAGGCTTAG. ok296d1u1 = 290bp product with WT allele. ok296d2u1 = 352 bp product with ok296 allele.

1237bp deletion in cosmid F57F5. Break points are 743 and 1980 with respect to F57F5. Sequence at the break point is: TGAGAAGTTTATAAAAAAGTA / AAACTTAAGAGTTTTCAGTCA. Primers: ok232u1: GGATTGCTTACGTGCATC; ok232d1: ATTACATTTGCAGAAACTCG; ok232d2: CTCTTCTCACTCAAATGATG. ok232u1/d1 = 322bp product with WT allele. ok232d2/u1 = 397bp product with ok232 allele.

juEx595 [IFB-1b::GFP + rol-6(su1006)]. Maintain by picking Rollers. GFP expression patterns are similar to MH4 staining. Maintain by picking rollers.

ju487 is a gain-of-function allele of syd-2, changing Arg184 to Cys. Reference: Dai Y, et al. Nat Neurosci. 2006 Dec;9(12):1479-87. doi: 10.1038/nn1808. PMID: 17115037.

juIs14 [acr-2p::GFP + lin-15(+)] IV. GFP expression in cholinergic motor neurons. Reference: Hallam SJ, et al. Development. 2000 Oct;127(19):4239-52.

juEx1434 [rgef-1p::ebax-1::GFP + rol-6(su1006)]. Pick Rollers to maintain. juEx1434 rescues Egl of pqn-55(ju699) mutants. Reference: Wang Z., et al. Neuron. 2013 Sep 4;79(5):903-16.

juIs52 [vab-2::GFP + rol-6(su1006)]. Rescuing GFP-tagged VAB-2 transgene. Rollers. vab-2 formerly known as efn-1.

adEx1299 [avr-15::GFP + rol-6(su1006)]. GFP expression in pharyngeal muscle and some extrapharyngeal neurons. Maintain by picking Rollers.

Moderate resistance to ivermectin. NOTE: originally described as carrying ad1302, but reported to actually be ad1305; see strain JD740 for verified avr-14(ad1302) I; avr-15(ad1051) V double mutant. Do not distribute this strain; other labs should request it from the CGC.

adEx1350 [kin-18::GFP + rol-6(su1006)]. Pick Rollers. Only about 10% transmission.

Bacteria. Str-R. L10 papilla 2; sporulation-defective mutant. This is a low-quality food that is difficult for the worms to eat, and is useful for studies of the effect of food on behavior, physiology, etc. [NOTE: This strain grows better on NGM than on LB media in CGC.] Described in J Exp Biol 206: 2441-2457. Biosafety Level: BSL-1.

Bacteria. Str-R. Streak and maintain on Str+ plates. NGMSR+. Faster growing papilla on NGMSR. [NOTE: This strain grows better on NGM than on LB media in CGC.] Biosafety Level: BSL-1.

adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers.

Superficially wild-type; multiple subtle phenotypes related to nutritional response. References: Kang C, You YJ, Avery L. Genes Dev. 2007 Sep 1;21(17):2161-71. Kang C, Avery L. Genes Dev. 2009 Jan 1;23(1):12-7.

Roller Unc. e754 is cold-sensitive: lethal at 15C.

Abnormal feeding. Falls asleep. Does not feed while asleep. Semidominant. Previously called eat-7.

Abnormal feeding. Slippery Corpus. Long. Slight coiler Unc. gpb-2(ad541) previously called eat-11(ad541).

Mild Unc-tends to form abnormally deep bends, especially when backing. Mild Eat.

Abnormal feeding. Relaxation defective. Smallish. Males don't mate. Semidominant. Previously called eat-12. See also WBPaper00002912.

Note: ad702 was isolated in an RC301 background. DA702 was not tested for the presence of npr-1(g320) following three rounds of outcrossing to N2 Bristol. DA702 does not display clumping behavior, so it's likely that DA702 has the Bristol npr-1. New stock rec'd 10/13/99.

Heterozygotes are Blistered and Eat (terminal bulb relaxation defective). Heterozygotes segregate BliEat, BliEatUnc and dead eggs. ad695 previously called eat-12.

Roller. Unc. Vulvaless. Throws males. sc8 previously called rol-4(sc8).

n582 is Egl, Lon, slow & floppy. Suppressed by ad952, which is semidominant. Strain is slightly Dpy and the pharyngeal bulb occasionally shows delayed relaxation and repolarization.

Heterozygotes are WT and GFP+ in the pharynx. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Presence of ces-1 is inferred from strain construction but not experimentally verified. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.

uqIs5 [lbp-2p::lbp-2::TagRFP]. Age-dependent aggregation of LBP-2::TagRFP in the pseudocoelom. Reference: Gallotta I, et al. Nature. 2020 Jul 8. doi: 10.1038/s41586-020-2461-z.

mkcSi13 [sun-1p::rde-1::sun-1 3'UTR + unc-119(+)] II. Germline rescue of the rde-1(mkc36) indel mutation, allowing germline-specific RNAi. Reference: Zou L, et al. Scientific Reports Volume 9, Article number: 2354 (2019) "Construction of a germline-specific RNAi tool in C. elegans."

olaEx5329 [rab-3p::HYlight + elt-7p::mCherry]. Pick mCherry+ animals to maintain. Pan-neuronal expression of HYlight, a codon-optimized biosensor that responds to changing levels of FBP in cells. Reference: Wolfe AD, et al. Proc Natl Acad Sci U S A. 2024 Jan 16;121(3):e2314699121. doi: 10.1073/pnas.2314699121. PMID: 38198527.

olaIs138 [ttx-3p::SL2::HYlight::let-858 3'UTR + elt-7p::mCherry] IV. Expression of HYlight, a codon-optimized biosensor that responds to changing levels of FBP in cells, in the neuron pair AIY. Derived by UV/TMP insertion of the olaEx5367 transgene. Reference: Wolfe AD, et al. Proc Natl Acad Sci U S A. 2024 Jan 16;121(3):e2314699121. doi: 10.1073/pnas.2314699121. PMID: 38198527.

dnSi8 [tdp1::flag::mCherry + Cbr-unc119(+)] inserted into ttTi5605 on LG II. Nuclear-localized mCherry. dnIs22 [sup-46::GFP + unc-119(+)] (site of integration unknown). Strong nuclear-localized GFP expression. [NOTE: This strain was produced by crossing two parental strains carrying strong unc-119 loss of function alleles. One parent was carrying ed3; the allele in the other parental strain is unknown.]

0006. Rhabditella axei. Male/Female strain. Isolated by W. Sudhaus on July 29, 1979 from a compost heap in Esmoulieres, France. Grown easily on OP50 at 16-25C. See WBG 12(5) 14.