Search Strains

Forms dauer larvae non-conditionally but only arrests at dauer stage for 1-2 days, then grows to adult. daf-c but not ts - can grow at 15C or 20C.

Dauer defective. Dpy.

Maintain at 15C. Daf-C. Reference: Jensen VL, et al. PLoS Genet. 2010 Nov 24;6(11):e1001199.

Temperature sensitive dauer constitutive. Dpy. Unc.

Temperature sensitive dauer constitutive. Many dauers at 15C. Dpy. Heterozygotes Roll.

Temperature sensitive dauer constitutive. Dominant Twitcher

Dauer defective. Class 2 suppressor of dauer constitutives. Chemotaxis normal. See also WBPaper00002149. [Previously called daf-20.]

Dauer defective-leaky. Somewhat small. Suppresses daf-2.

Dauer defective. Chemotaxis normal. Class 2 suppressor of dauer constitutive.

Temperature sensitive dauer constitutive. 100% dauers at 25C. Dauer recovery poor at 15C. Maternal effect. Egg retainer.

Heterozygotes are WT and segregate WT, dauer constitutive, and Uncs. Lethal dauers.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Dpy and dauers. Dauers are lethal and SDS-sensitive. NOTE: WT recombinants that have lost dpy-13 can quickly overtake a population.

Heterozygotes are WT and segregate WT, Unc, and lethal dauers. Dauers are SDS-sensitive.

daf-d. Weak heterochronic phenotypes in seam, somatic gonad, intestine. Class III allele.

Heterozygotes are WT and segregate WT, dauers and DpyUnc.

Temperature sensitive dauer constitutive. Unc.

Temperature sensitive dauer constitutive. Dpy.

Temperature sensitive. Leaky at 25C. Dauers recover poorly at 15C. Dauers escape plates. Recessive. Chemotaxis defective (Na+). Received new stock from Riddle lab in November 2006.

Dauer defective.

Both unc-13 and daf-7 are suppressed by sup-7. sup-7 should be grown between 22.5C and 24C.

sup-7 suppress dauer formation. sup-7 should be grown between 22.5C and 24C.

Temperature sensitive Daf-c. Maintain at 15C. Adults Age and Itt, but not Unc (severe class 1 allele). m212 results in an amino acid substitution(C883Y) in the extracellular portion of the DAF-2 receptor (specificaly, the FnIII2ID domain).

Temperature sensitive dauer constitutive.

Temperature sensitive dauer constitutive. 100% dauers at 25C. Some dauers (3.5%) at 15C.

Temperature sensitive dauers. Paralyzed Unc. sus-1 suppresses the ability of eDp23 to suppress unc-15. eDp23 = sup-3(e1407).

Temperature sensititve dauer constitutive. Small. 100% dauers at 25C. 15% dauers at 15C.

SDS sensitive dauers. Non-crowder.

Temperature sensitive dauer constitutive. Small. Amber. Maintain at 15C.

WT phenotype, segregates WT, Egl (age-1 homozygotes) and DpyUncs. Egl animals give all non-recovering dauer larvae (m333 shows maternal effect), with variable radial shrinkage and variable resistance to 1% SDS. Pick WT to maintain and check for correction segregation of progeny. age-1(m333) pka daf-23(m333).

Heterozygotes are WT and segregate WT, Vul, Twitchers which are dauers (dauer constitutive) and dead eggs. Maintain by picking WT. Hets twitch in 1% nicotine.

Balanced lethal dauer constitutive. Heterozygotes are WT and segregate WT, LonDaf and Unc. Will get 3-5 adult Lon per clone. Maintain by picking WT.

Temperature sensitive dauer constitutive. Tight at 25C. Leaky at 15C. Chemotaxis normal.

Unc-weak kinker, doesn't back well. Temperature sensitive dauer constitutive. Maintain at 15C. Makes high percentage of dauers at 25C. tsp for dauer formation is L1 molt. Type C Egl. Active. Resistant to 1 mM levamisole. Sensitive to hypoosmotic shock.

Temperature sensitive dauer constitutive. Difficult to grow. 100% dauers at 25C. 90% dauers at 15C.

Heterozygotes are WT. At 25C the hets segregate DpyDafs, WT and Lon. At 15C the hets segregate Dafs, WT and Lon. [dpy-7(sc27) is temperature sensitive. At 25C it is larger than most Dpys and has a tendency to roll. Not expressed at 15C.] Maintain by picking WT.

Temperature sensitive dauer constitutive. Temperature sensitive fertilization defective. WT at 15C, segregates some dauers at 20C, sterile at 25C. Tightly linked.

Unc. Temperature sensitive dauer constitutive. Temperature sensitive fertilization defective (late). UncDaf at 25C, Unc at 15C.

Recessive maternal dauer constitutive. Maintain at 15C

daf-d. Weak heterochronic phenotypes in seam, somatic gonad, and intestine. Class III allele.

daf-d. Weak heterochronic phenotypes in intestine. Class III allele.

daf-d. Weak heterochronic phenotypes in seam, somatic gonad, intestine. Class III allele.

daf-d. Weak heterochronic phenotypes in seam, somatic gonad, intestine. Class III allele.

daf-d. Weak heterochronic phenotypes in intestine. Class III allele.

T2A::sGFP2(1-10) fused to the C-terminus of endogenous GLH-1. The T2A self-cleaving peptide separates sGFP2(1-10) from GLH-1 post-translationally so that sGFP2(1-10) disperses throughout germ cell nuclei and cytoplasm. sGFP2(1-10) is also maternally loaded into embryos, where it persists through early and mid-embryonic development. Proteins tagged with the 16aa GFP11 or M3 sequence will bind sGFP2(1-10) in the germline and early embryo to emit GFP fluorescence. Broods from DUP223 are similar to wild-type at permissive and restrictive temperatures. Transgene tag was inserted by CRISPR/Cas9 in an N2 background. [NOTE: (04/23/2021) The original stock received by the CGC was found to be carrying a second insertion, clu-1(sam131[GFP(11)::clu-1]. A new stock verified by to be carrying the correct transgene was received from DUP 05/04/2021.] Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.

T2A::wrmScarlet(1-10) fused to the C-terminus of endogenous GLH-1. The T2A self-cleaving peptide separates wrmScarlet(1-10) from GLH-1 post-translationally so that wrmScarlet(1-10) disperses throughout germ cell nuclei and cytoplasm. wrmScarlet(1-10) is also maternally loaded into embryos, where it persists through early and mid-embryonic development. Proteins tagged with the 18aa wrmScarlet(11) sequence will bind wrmScarlet(1-10) in the germline and early embryo to emit wrmScarlet fluorescence. Broods from DUP237 are similar to wild-type at permissive and restrictive temperatures. Transgene tag was inserted by CRISPR/Cas9 in an N2 background. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.

Heterozygotes segregate wild-type GFP+ heterozygotes, GFP+ Dpy, and sec-5 homozygotes (scrawny, small broods, abnormal gut appearance) sec-5 is homozygous maternal-effect lethal; M+Z- animals produce a few dead L1-L2 stage larvae with Vab defects. Pick GFP+ wild-type to maintain. Based upon phenotype, pk2357 is a strong loss-of-function, but likely not a null allele; molecular lesion produces a premature stop at position 389. Reference: Frische EW, et al. EMBO J. 2007 Dec 12;26(24):5083-92. [NOTE: This strain was previously described as carrying pk2358, but pk2357 is the correct allele. Both pk2357 and pk2358 cause the same nonsense (amber) change.]

mNeonGreen tag inserted at 3' end of endogenous daf-15 locus. Ubiquitous expression.

Gain-of-function allele (G12V). Low penetrance of 3˚ to 1˚ fate transformations (Muv) and duplication of the excretory duct cell. Genotyping primers (Tm=50C, followed by BamHI digestion): oNR122: TGTGTCATCTGGTCTGTACTTGG; oNR123: TCCCCTGCACGAATTGTACC. Reference: Rasmussen NR, Dickinson DJ, and Reiner DJ. Genetics Dec;210(4):1339-1354. doi: 10.1534/genetics.118.301601. PMID: 30257933.

mNeonGreen tag inserted at 3' end of endogenous daf-15 locus; AID* at 3' end of mNeonGreen. Ubiquitous expression. Transgene can be degraded in a background expressing TIR1 co-factor and supplemented with auxin.