Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
GC565 C. elegans pro-1(na48)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Heterozygotes are WT with GFP+ (pharynx) and segregate Dpy with GFP+ (pharynx) and slow growing GFP- animals which are generally sterile (with germline tumor at 25C). pro-1(na48) is a weak, recessive, loss-of-function allele that behaves as a stronger loss-of-function at lower temperatures. At 25C, 85% of na48 animals will develop a proximal germline tumorr. Although tumors are less common at lower temperatures, the animals are generally sterile due to low proliferation and somatic gonad defects. na48 animals are slow growing at all temperatures.
GC613 C. elegans eef-1A.1(ar229) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Steriles (homozygous ar229), Unc-36 (homozygous eT1), and dead eggs. ar229 have severely reduced germline proliferation.
GE1936 C. elegans xpf-1(e1487) II; unc-24(e138) atg-7(t1738)/nT1[let (m435)] IV; dpy-11(e224)/nT1[let (m435)] V. Show Description
Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1738 homozygotes that produce dead embryos. GE1936 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE1939 C. elegans xpf-1(e1487) II; unc-24(e138) trcs-1(t1745)/nT1[let (m435)] IV; dpy-11(e224)/nT1[let (m435)] V. Show Description
Temperature-sensitive maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1745 homozygotes that produce dead eggs at restrictive temperature. GE1939 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE1958 C. elegans xpf-1(e1487) II; unc-24(e138) atg-7(t1726)/nT1[let (m435)] IV; dpy-11(e224)/nT1[let (m435)] V. Show Description
Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1726 homozygotes that produce dead embryos. GE1958 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2001 C. elegans xpf-1(e1487) II; unc-24(e138) IV/nT1(IV;V); dpy-11(e224) ccz-1(t2070) V/nT1 (IV;V). Show Description
Him. Wild-type heterozygotes segregate WT heterozygotes and Dpy Unc ccz-1 homozygotes (produce only arrested embryos). ccz-1 embryos have spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.
GE2047 C. elegans xpf-1(e1487) II; unc-24(e138)/nt1[let (m435)] IV; dpy-11(e224) cept-2(t2021)/nt1[let (m435)] V. Show Description
Temperature-sensitive maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2021 homozygotes that produce dead eggs at restrictive temperature. GE2047 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2122 C. elegans xpf-1(e1487) II; unc-24(e138)/nt1[let (m435)] IV; dpy-11(e224) cept-2(t2007)/nt1[let (m435)] V. Show Description
Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2007 homozygotes that produce dead eggs. GE2122 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2153 C. elegans xpf-1(e1487) II; unc-24(e138) wapl-1(t1773)/nt1[let (m435)] IV; dpy-11(e224)/nt1[let (m435)] V. Show Description
Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1773 homozygotes that do not produce viable progeny. GE2153 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2305 C. elegans xpf-1(e1487) II; unc-24(e138) wapl-1(t1867)/nt1[let (m435)] IV; dpy-11(e224)/nt1[let (m435)] V. Show Description
Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1867 homozygotes that do not produce viable progeny. GE2305 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2335 C. elegans xpf-1(e1487) II; unc-24(e138)/nT1[let (m435)] IV; dpy-11(e224) dlat-1(t2056)/nT1[let (m435)] V. Show Description
Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2056 homozygotes that produce dead eggs. GE2335 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2391 C. elegans xpf-1(e1487) II; unc-24(e138) perm-5(t1932)/nT1[let (m435)] IV; dpy-11(e224)/nT1[let (m435)] V. Show Description
Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1932 homozygotes that produce dead embryos. GE2391 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2453 C. elegans xpf-1(e1487) II; unc-24(e138) perm-5(t1900)/nT1[let (m435)] IV; dpy-11(e224)/nT1[let (m435)] V. Show Description
Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1900 homozygotes that produce dead embryos. GE2453 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2512 C. elegans xpf-1(e1487) II; unc-24(e138) trcs-1(t1909)/nT1[let (m435)] IV; dpy-11(e224)/nT1[let (m435)] V. Show Description
Leaky temperature-sensitive maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1909 homozygotes that produce dead eggs at restrictive temperature. GE2512 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2516 C. elegans xpf-1(e1487) II; unc-24(e138) IV/nT1(IV;V); dpy-11(e224) ccz-1(t2071) V/nT1 (IV;V). Show Description
Him. Wild-type heterozygotes segregate WT heterozygotes and Dpy Unc ccz-1 homozygotes (produce only arrested embryos). ccz-1 embryos have spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.
GE2541 C. elegans xpf-1(e1487) II; unc-24(e138)/nT1[let (m435)] IV; dpy-11(e224) dlat-1(t2035)/nT1[let (m435)] V. Show Description
Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2035 homozygotes that produce dead eggs. GE2541 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2576 C. elegans unc-32(e189) baf-1(t1639)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.
GE2614 C. elegans unc-32(e189) faf-1(t1678)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.
GE2734 C. elegans xpf-1(e1487) II; unc-24(e138)/nt1[let (m435)] IV; dpy-11(e224) C56A3.8(t2029)/nt1[let (m435)] V. Show Description
Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2029 homozygotes that produce unfertilized oocytes. GE2734 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2827 C. elegans xpf-1(e1487) II; unc-24(e138) T22B11.1(t1786)/nt1[let (m435)] IV; dpy-11(e224)/nt1[let (m435)] V. Show Description
Temperature-sensitive maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1786 homozygotes that produce unfertilized oocytes at restrictive temperature. GE2827 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2886 C. elegans xpf-1(e1487) II; unc-24(e138)/nt1[let (m435)] IV; dpy-11(e224) C56A3.8(t2055)/nt1[let (m435)] V. Show Description
Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2055 homozygotes that produce unfertilized oocytes. GE2886 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2895 C. elegans xpf-1(e1487) II; unc-24(e138) T22B11.1(t1866)/nt1[let (m435)] IV; dpy-11(e224)/nt1[let (m435)] V. Show Description
Temperature-sensitive maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1866 homozygotes that produce unfertilized oocytes at restrictive temperature. GE2895 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE68 C. elegans glp-1(e2144) III. Show Description
Sterile at 25C, maintain at 15C. NOTE (11/16/10 - J. Hubbard): This strain is NOT synonymous with glp-1(e2141) as previously reported in Kodoyianni V, Maine EM, Kimble J. (1992) [Molecular basis of loss-of-function mutations in the glp-1 gene of Caenorhabditis elegans. Mol Biol Cell. 3,1199-213. PMID: 1457827]. As reported in WBG article by Dalfó D, Priess J, Schnabel R and Hubbard J. (2010) [glp-1(e2141) sequence correction. The Worm Breeders Gazette. 18-3.], e2144 carries the mutation c2785t in exon 8, leading to the amino acid change L929F, whereas e2141 carries the mutations c2920t and a3610g in exon 8, leading to the amino acid changes R974C and T1204A.
GLW2 C. elegans attf-2(utx2[mNG::attf-2]) V. Show Description
Superficially wild-type. N-terminal tag of ATTF-2 via CRISPR/Cas9 knock-in of mNeonGreen at attf-2 locus. Insertion verified by PCR. Left flank: 5' cttttttgctcacatcatcatttttcagtc 3'; Right flank: 5' ATGTCGGCCGAGACCGCGACTATCCCCGAAGTTTC 3' (5 silent mutations). sgRNA: 5' CGAAACTGCAACCATACCCG 3'
GLW25 C. elegans daf-18(utx19[mNG::3xFlag::daf-18]) IV. Show Description
Superficially wild type. N-terminal tag of DAF-18 via CRISPR/Cas9 knock-in of mNeonGreen at daf-18 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcagtttccaggtacatctactaaccccca 3'; Right flank: 5' ATGGTTACTCCTCCTCCAGATGTGCCAAGC 3'; sgRNA: GGAGGAGGAGTAACCATtgg; Cas9/sgRNA plasmid: pGLOW27; mNG^SEC^3xFlag plasmid: pGLOW53; SEC insertion allele strain: GLW24. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.
GLW33 C. elegans T28D6.6(utx25[T28D6.6::mNG::3xFlag]) III. Show Description
Superficially wild type. C-terminal tag of T28D6.6 via CRISPR/Cas9 knock-in of mNeonGreen at T28D6.6 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gtcgcaaataatggttttttttccagAGTC 3'; Right flank: 5' TAAgctgaaattcccgtgcttctcgtcttc 3'; sgRNA: gggaatttcagcTTAGACTc; Cas9/sgRNA plasmid: pGLOW2; mNG^SEC^3xFlag plasmid: pGLOW42; SEC insertion allele strain: GLW32. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.
GLW4 C. elegans gyf-1(utx4[gyf-1::mNG]) II. Show Description
Superficially wild-type. C-terminal tag of GYF-1 via CRISPR/Cas9 knock-in of mNeonGreen at gyf-1 locus. Insertion verified by PCR. Left flank: 5' CCATCGGCTCCGGTGAATCCTTCGCGCCGT 3'; Right flank: 5' TAGatgagtcatttctttttccagctttaa 3'. sgRNA: 5' TGACTCATCTAACGGCGCGA 3'
GOU2042 C. elegans eff-1(cas618 [eff-1::gfp]) II. Show Description
GFP inserted into the endogenous eff-1 gene at its C-terminus by Cas9-triggered homologous recombination. Green fluorescence enriched in V.a cell 20min before cell-cell fusion in larvae. Very weak fluorescence in hyp7 cell. Reference: Yang Y, et al. Dev Cell. 2017 Apr 10;41(1):107-120.
GR1032 C. elegans age-1(mg44)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT and DpyUnc. age-1(mg44) homozygotes from heterozygous mothers are WT and segregate only dauers at all temperatures. mg44 pka daf-23(mg44).
GR1307 C. elegans daf-16(mgDf50) I. Show Description
Deficiency completely eliminates daf-16 coding region. Makes partial dauers on pheromone.
GR1308 C. elegans daf-16(mg54) I; daf-2(e1370) III. Show Description
mg54 almost completely suppresses the daf-c phenotype of daf-2. 0.4% dauers.
GR1309 C. elegans daf-16(mgDf47) I; daf-2(e1370) III. Show Description
mgDf47 completely suppresses daf-c phenotype of daf-2. mgDf47 deletes approximately 8kb of the daf-16 gene beginning after exon 4.
GR1310 C. elegans akt-1(mg144) V. Show Description
No visible phenotype. Dominant suppressor of daf-c phenotype of age-1.
GR1311 C. elegans daf-3(mgDf90) X. Show Description
mgDf90 completely eliminates the daf-3 coding region.
GR1318 C. elegans pdk-1(mg142) X. Show Description
No visible phenotype. Dominant suppressor of daf-c phenotype of age-1. Ala303Val substitution.
GR1336 C. elegans daf-2(e1370) III; njEx32. Show Description
njEx32 [ges-1p::daf-2(+) + ges-1p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.
GR1337 C. elegans daf-2(e1370) III; njEx38. Show Description
njEx38 [unc-54p::daf-2(cDNA)::unc-54 3'UTR + unc-54p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.
GR1339 C. elegans daf-2(e1370) III; mgEx376. Show Description
mgEx376 [unc-14p::daf-2 + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.
GR1340 C. elegans daf-2(e1370) III; mgEx373. Show Description
mgEx373 [unc-119p::daf-2(cDNA)::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.
GR1352 C. elegans daf-16(mgDf47) I; xrIs87. Show Description
xrIs87 [daf-16(alpha)::GFP::daf-16B + rol-6(su1006)]. Rollers. GFP expressed in many tissues. Partially rescued for daf-16 (daf-d).
GR1455 C. elegans mgIs40. Show Description
mgIs40 [daf-28p::GFP].
GR1895 C. elegans daf-2(e1370) III; mgIs67. Show Description
mgIs67 [daf-16p::daf-16::GFP + rol-6(su1006)]. Temperature-sensitive. Daf-c. Maintain at 15C. Dauer formation at 25C. Slow growing. Dauer-like at 20C. DAF-16::GFP is fully nuclear at 20C. Reference: Riedel CG, et al. Nat Cell Biol. 2013 May;15(5):491-501.
GR1973 C. elegans mgIs63. Show Description
mgIs63 [sdf-9p::RFP]. RFP expressed in the XXX cells. Reference: Hu PJ, Xu J, Ruvkun G. PLoS Genet. 2006 Jul;2(7):e99.
GR2062 C. elegans eri-7(mg369) I. Show Description
Loss-of-function allele; stronger than eri-7(mg411). Reference: Fischer SE, et al. Nature. 2008 Sep 25;455(7212):491-6.
GR2107 C. elegans daf-2(e1370) III; mgEx371. Show Description
mgEx371 [dpy-30p::daf-2(cDNA)::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.
GR2117 C. elegans daf-2(e1365) III; mgIs35. Show Description
mgIs35 [ins-1(genomic) + mec-7p::GFP]. Temperature-sensitive. Maintain at 15C. Daf-c. High penetrance of dauer formation at 20C. Integration of mgEx557. Reference: Pierce SB, et al. Genes Dev. 2001 Mar 15;15(6):672-86.
GR2118 C. elegans daf-9(e1406) dpy-7(sc27) X; mgEx663. Show Description
mgEx663 [dpy-7p::daf-9B(cDNA)::GFP + mec-7::GFP]. Pick GFP+ to maintain. GFP fusion containing 0.4 kb dpy-7 promoter and daf-9 isoform B cDNA. Reference: Mak HY, Ruvkun G. Development. 2004 Apr;131(8):1777-86.
GS3754 C. elegans sel-13(ok303) III; arIs51 IV; sel-7(n1253) unc-3(e151) X. Show Description
arIs51[cdh-3::GFP]. sel-13=T04A8.10. Reported strong daf-c; raise at 15 C (personal communication to the CGC). Do not distribute this strain; other labs should request it from the CGC.
GW1394 C. elegans gwIs39 III; bqSi225 IV; gwIs59. Show Description
gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. bqSi225 [emr-1p::emr-1::mCherry + unc-119(+)] IV. gwIs59 [pha-4::mCherry::256xLacO::4xLexA + unc-119(+)]. Superficially wild-type. Express ubiquitous EMR-1::mCherry at the nuclear periphery. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have red intestine (all stages) and green intestine (from late L4 stage). Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421.
GW1480 C. elegans bqsi433 II; bqSi495 IV; ygIs1. Show Description
bqsi433 [hsp16.41p::FRT::mCherry::his-58::FRT::dam::emr-1 + unc-119(+)] II. bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. ygIs1 [baf-1p::GFP::lamin(wt) + unc-119(+)]. Strain used to perform muscle specific EMR-DamID, to map lamina-associated domains (LADs). Strain also has low level over-expression of GFP::LMN-1. Might still carry unc-119(ed3) or (ed9) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421