Search Strains

Heterozygotes are Unc (Rubberband) and segregate Unc, DpyUnc and early larval lethals (nDf6 homozygotes). Maintain by picking Unc non-Dpy.

Hets are Unc(Rubberband) and Egl. Segregate Unc, DpyUnc and early larval lethals (L1). Maintain by picking Uncs. Received new stock 1/3/94.

n2812 is a strong loss-of-function allele and a maternal effect lethal.

n1761 cuases a partially penetrant "rod-like" larval lethal phenotype (70% at 20C) and a partially penetrant vulvaless phenotype (30% at 20C). It is a splice site defect predicted to eliminate 62 amino acids at the C-terminus.

Suppressor of ced-9(n1950n2161) maternal effect lethality.

Medium strong allele. Suppressor of ced-9(n1950n2161) maternal effect lethality.

Medium-strong alllele; suppresses of ced-9(n1950 n2162) maternal effect lethality. Reference: (1999) Genetics 153(4):1655-71.

Suppressor of ced-9(n1950n2161) maternal effect lethality. Strong allele of ced-3.

Suppressor of ced-9(n1950n2161) maternal effect lethality.

Animals are Egl and show sluggish locomotion and foraging behavior. Null allele: egl-10 is deleted or severely rearranged, and EGL-10 protein is undetected by Western blotting and in situ staining of animals.

nIs93 [(pJHT27)lin-36p::GFP::lin-36 (full-length coding) + rol-6(su1006)]. Rollers. Non-Muv -- nearly completely penetrant rescue of Lin-36. Reference: Thomas & Horvitz (1999) Development 126(15):3449-59.

Heterozygotes are WT and segregate WT, Sterile Dpys, and Mel Uncs. cup-5(n3194) is a Q139 ochre allele with a maternal effect lethal phenotype including accumulation of refractile bodies resembling apoptotic cells in some regards. cup-5 homozygotes are also defective in coelomocyte uptake.

n3247 is a 791 bp deletion which results in a truncated TBH-1 protein. Hypersensitive to 5-HT. Reduced locomotion rate.

Serotonin hypersensitive. Isolated as a 1688 bp deletion. Backcrossed 6 times using PCR as the assay to follow mutant chromosome. 5-HT hypersensitivity phenotype does segregate after 6 backcrosses. Hyperslowing in locomotion assay as well.

Heterozygotes are WT and segregate WT, DpyUnc and Sterile Unc-4s. n3316 is Mel. 1422 bp deletion removes cosmid T23G7 nt 5200-6621.

Heterozygotes are WT and GFP+. Pick GFP+ to maintain -- viable pf88 homozygotes (Pvl Egl) can overtake the balanced population. nT1[qIs51] is homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. Reference: Verghese E, et al. Dev Biol. 2011 Aug 15;356(2):516-28.

Homozygous viable with no obvious morphological, locomotory, or behavioral phenotypes. However, these animals display cilia-related chemosensory (Che) defective and dye-fill (Dyf) defective phenotypes. 2009 bp deletion with flanking sequences of GATAAGAGGAAATCTTTTTGGAGAGTTGGA and ATTTAGTTTTTCACAAAGAACACCGCAATA.

Displays Dyf, Che and Odr phenotypes. nx77 is a double deletion in bbs-8. Nucleotides 612-759 and 826-1631 of bbs-8 (numbers refer to unspliced gene sequence) are removed.

C. elegans var Bristol. Generation time is about 3 days. Brood size is about 350. Also CGC reference 257. Isolated from mushroom compost near Bristol, England by L.N. Staniland. Cultured by W.L. Nicholas, identified to genus by Gunther Osche and species by Victor Nigon; subsequently cultured by C.E. Dougherty. Given to Sydney Brenner ca. 1966. Subcultured by Don Riddle in 1973. Caenorhabditis elegans wild isolate. DR subclone of CB original (Tc1 pattern I). [NOTE: This stock might carry a ~1.8 kb deletion in alh-2 in the background. (UPDATE: 03/26/2018 - a user reported the stock they received was homozygous for the alh-2(ot588) mutation.)]

Heterozygotes are WT and segregate WT, DpySteriles, dead eggs, and arrested L1 larvae (feh-1 homozygotes). feh-1 corresponds with some modification to Y54F10AM.2. feh-1(gb561) is a double deletion within feh-1 and is a null mutation.

Heterozygotes are WT and segregate WT, Dpy, dead eggs, and arrested L1 larvae (feh-1 homozygotes). feh-1corresponds with some modification to Y54F10AM.2. feh-1(gb561) is a double deletion within feh-1 and is a null mutation.

Male tail structure defective. kal-1(gb503) is a 2121 bp deletion (14678 to 12577 in cosmid K03D10). Putative null allele.

Heterozygotes (wrn-1/mIn1;exo-1) are WT and GFP+. mIn1 homozygotes (mIn1;exo-1) are Dpy and GFP+. wrn-1;exo-1 homozygotes are non-GFP.  Reference: Ryu, J.S. and Koo, H.S. (2017). FEBS Lett.

Incompletely-penetrant exploding vulva. wd26 (E580K) is an intragenic revertant of the e262 allele for the backward movement phenotype; it is not known if it also modifies other e262 phenotypes. The wd26 lesion (E580K) is molecularly identical to wd14, wd16, wd17, wd18, etc. Reference: Pflugrad A, et al. Development. 1997 May;124(9):1699-709.

2 kb deletion mutant made by OMRF Knockout Group. Presumptive null. No obvious phenotype. Primers used: EL1: GAAACGGTGAGTGCCAATTT. ER1: AGTGCTGTCACACCAAGCAC. IL1: AAACCAACTGACCCAAGGTG. IR1: TATCTAGGGTCCGCACAACC. Left breakpoint sequence: AGGTTGACAAATTGTTGCGA. Right breakpoint sequence: CGCTTATTAAAAAATAATAT.

No obvious phenotype. 1.5 kb deletion of acr-5 produced by Moulder/Barstead at OMRF. Left breakpoint sequence: TGGGTGATGCTATATGCACA. Right breakpoint sequence: TAGACTTCCGAGCAATAATTC.

No obvious phenotype. 2 kb deletion of acr-5 produced by Moulder/Barstead at OMRF. Deletion removes all 4 transmembrane domains. This is likely a null allele. Left breakpoint sequence (includes repeated sequence): TTTTTAATTATCCGTAATTTTTTAATTATCCGTAAT. Right breakpoint sequence: AACATCTTTAATCGATTTAT.

No obvious phenotype. 2.4 kb deletion of acr-5 produced by Moulder/Barstead at OMRF.

Heterozygotes are WT and GFP+. nT1[qIs51] is probably homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. fbl-1(tk45) homozygotes are Dpy, Sterile and are Distal Tip migration defective.

Heterozygotes are WT and segregate WT, Sterile Dpys (e1259 is ts) and L1-L2 lethals which have an abnormal head (often notched) and are Ham.

mIs14 [myo-2p::GFP + pes-10p::GFP]. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ heterozygotes, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP or302 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. or302 homozygotes are GFP- and are Emb, ABar and have EMS spindle misalignment. or302 is a deletion starting at 503 and ending at 1578 of C27A2.6.

mIs14 [myo-2p::GFP + pes-10p::GFP]. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ heterozygotes, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP or301 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. or301 homozygotes are GFP- and Emb. or301 is a deletion starting at 6568 and ending at 8162 of C34F11.9a.

Low penetrance (about 25%) embryonic lethality and reduced brood size. wsp-1(gm324) is an N-terminal deletion that exhibits no observable mRNA or protein.

Heterozygotes are WT and segregate WT, Sterile Dpys and Clear lethals (die as L1-L2s). Differentiation of AIY, CAN defective.

Heterozygotes are Unc and segregate Unc, SmaUnc and larval lethals. Putative null allele.

No obvious phenotype. The primers used to isolate (ok198)were: LS969.E1: TGAGCTCGGAGATGTTGCT; LS969.E2: CCGGTCATTCCTCATTCACT; LS969.I1: GGGAGGGTCTTACGTTGTGA; LS969.I2: GTCGAAAAATCAACTTGCGG; The deletion band runs at about 2000bp. The wt band (based on the inside primers) is 3195bp making the deletion about 1200bp of the gene F54A5.3.

Daf-constitutive allele rh62 forms partial-dauer larvae under replete conditions at all temperatures.

Formation of large round cysts in the excretory canal. The cysts begin to form shortly before hatching and is penetrant. The cysts grow in size throughout larval and adult stages, and can be lethal. The cysts form primarily at the cell body. Some of the larger cysts may be visible by low power microscopy. Slight variable defects in the tail whip. 100% penetrant.

Short excretory canal, incomplete QR, HSN migrations, post DTC loops.

Formation of large round cysts in the excretory canal. The cysts begin to form shortly before hatching and is penetrant. The cysts grow in size throughout larval and adult stages, and can be lethal. The cysts form primarily at the cell body. Some of the larger cysts may be visible by low power microscopy. Slight variable defects in the tail whip.

Delayed hatching from egg shell. QL and descendant cells migrate forward instead of backward (incomplete penetrance). QR and descendant cells migrate backward instead of forward (weak penetrance). Semidominant with respect to cell migration.

Formation of large round cysts in the excretory canal. The cysts begin to form shortly before hatching and is penetrant. The cysts grow in size throughout larval and adult stages, and can be lethal. The cysts form primarily at the canal tips. Some of the larger cysts may be visible by low power microscopy. Slight variable defects in the tail whip. Impenetrant distal tip cell migration defects (Mig).

Excretory canal defect. Canal varies in length from no outgrowth to almost complete outgrowth. Frequent small vacuoles and extra branchings in the canal lumen visible only by Nomarski microscopy. Animals are somewhat pale.

CRISPR-engineered deletion of ddr-2. Low penetrance Rup. Reference: Park K, et al. eLife. 2023 Jul 5;12:RP87037. doi: 10.7554/eLife.87037. PMID: 37405383.

Endogenously tagged temperature sensitive glycine substitution mutant allele (b117) of emb-9. Tagged with mNG at the C-terminus. Temperature sensitive. Semi-dominant. Egg lethal. Not maternal. Will grow at 20C. See also CGC DH117. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.

qyIs138 [unc-62p::rde-1(genomic) + myo-2::YFP + unc-119(+)]. VPCs sensitive to RNAi. Vul phenotype from lin-39 RNAi depletion.

qyIs139 [unc-62p::rde-1(genomic) + myo-2::YFP + unc-119(+)]. VPCs sensitive to RNAi. Vul phenotype from lin-39 RNAi depletion.

2.6 kb deletion. pk87 homozygotes have a variable defect in hyp10 morphogenesis; most obvious in L1-L2 larvae. Rescued by WT copy of cdh-3 present on cosmid ZK112.

Deletion between: (exon 2): CCCAGAAGGCTT and (intron 4): ATATATATATATAGAC (complex rearrangement in between).

pkEx467 [acy-2(+) + rol-6(su1006)]. pk465 was isolated from a chemical deletion library and has a deletion of the first catalytic domain and the two multiple transmembrane regions of the predicted ACY-2 protein. The phenotype of pk465 is early larval lethality. The lethal phenotype of pk465 is rescued in NL1242 by a transgene containing WT acy-2 (cosmid C10F3) and rol-6.