Heterozygotes are Unc (Rubberband) and segregate Unc, DpyUnc and early larval lethals (nDf6 homozygotes). Maintain by picking Unc non-Dpy.

WT PHENOTYPE. This strain should throw dead eggs, but it is not doing so. Hasn't been checked to see if the deficiency is still there.

lucIs24 [mir-52p::mirtron-51 + elt-2::dsRed + myo-2::mCherry]. Pick GFP+ animals to maintain balanced line. Balanced mir-51 family mutant expressing a mirtron-version of mir-51. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP, arrested nT1[qIs51] aneuploids, and non-GFP mir-51 family homozygous mutants. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Non-GFP mir-51 family homozygous mutants rescued by mirtron-51 transgene are viable, but slow-growing and sick. Strain is derived from injection into parental strain MT17143. lucIs24 is a spontaneous integrant originating from a complex extra-chromosomal array, the genomic location of the transgene is unknown. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.

mir-357 and mir358 are deleted in this strain. Deletion breakpoints are:TTCTGTTTGACGATGATG / GGGACGATTCAACGGTCA...CATTTAATGTATTTCACAT / CTTTTTGGGTTACTGTAGTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

mir-239a and mir-239b are deleted in nDf62. Deletion breakpoints are:GAGTTTTTAACAGTTTCG / CCACTGGCGCTACTC...AATTGTCGACCAAAAAAAT / CTTGCTATAGTTAAATATTCAATTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

mir-253 and part of F44E7.5 are deleted in nDf64. Deletion breakpoints are:GATATCCTCACACTTTGGCAAAGAGTGCTT / GTTGAAGACGGTGAAAACATCCGAATTTTCAGGGAAGTT...TGAGATAAGAACACAAA GAATTCGATTTTC / GTGAATTCTGAACGAAACTTTACGTTTTGGACAGTAAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

4x outcrossed autosomes; 2x outcrossed X chromosome. Homozygous by PCR. Reference: Curr Bio (2010) 20:367-73.

Deletion breakpoints are: TATTTGCCAAAAATGGAAATTTT / CGGCAAATCGGGAAGCC...AGCTCGTCGGAAGCAATTG / GCTCCGCGTAATTGGAGCCCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.

Heterozygote. [NOTE: (11/14/2018) This strain was originally described as carrying mir-52(n4114), but the allele is actually n4100.] Reference: Curr Bio (2010) 20:367-73.

Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.

Reference: Curr Bio (2010) 20:367-73.

Both deletions are homozygous by PCR. mir-63, mir-229, mir-64, mir-65, and mir-66 are related in sequence. nDf63 removes mir-229, mir-64, mir-65, and mir-66. nDf63 was outcrossed 6x; n4568 has been outcrossed 2x. Reference: Curr Bio (2010) doi:10.1016/j.cub.2009.12.051.

Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.

Heterozygotes are WT and segregate WT, DpyUncas and dead eggs.

Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.

Heterozygotes are WT and segregate WT, DpyUnc and dead eggs. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.