Search Strains

Daf-d, weak heterochronic phenotypes in seam, somatic gonad, intestine. Class III allele.

Daf-c, gonadal Mig, weak heterochronic phenotypes in intestine and seam. Class VI allele.

Strong heterochronic phenotypes in seam, somatic gonad, and intestine. Heterochronic phenotypes less penetrant at 15C. Weakly daf-c at 25C. Class IV allele.

daf-c. Gonadal Mig. Weak heterochronic phenotypes in intestine. Class VI allele.

Mig on low cholesterol. Reference: Magner DB, et al. Cell Metab. 2013 Aug 6;18(2):212-24. doi: 10.1016/j.cmet.2013.07.007.PMID: 23931753

staEx1 [T20F7.6p + pha-1(+)]. Empty vector control strain. Maintain at 25 degrees. Superficially wild-type. Reference: Greer EL et al Curr Biol 2007 Oct 9;17(19):1646-56.

shEx34 [myo-3p::mCherry]. Pick mCherry+ to maintain. This strain serves as a control strain to ABR16. Reference: Han S, et al. Nature 2017 doi: 10.1038/nature21686.

shEx1 [ges-1p::fat-7 + myo-3p::mCherry]. Pick mCherry+ to maintain. FAT-7 over-expressing strain. ABR14 serves as a control strain for this strain. Reference: Han S, et al. Nature 2017 doi: 10.1038/nature21686.

hjIs37 [vha-6p::mRFP-PTS1 + Cbr-unc-119(+)]. ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. mRFP targeted to peroxisomes in intestinal cells. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets. Derived by crossing parental strains VS10 and LIU1 and outcrossing six times to ABR lab stock of N2. Reference: Papsdorf K, et al. Nat Cell Biol. 2023 May;25(5):672-684. doi: 10.1038/s41556-023-01136-6. 2023. PMID 37127715.

acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4).

acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4). This triple mutant strain was made by crossing the acd-1(sta6) delm-2(ok1822) double mutant with delm-1(ok1226) parental strain RB1177.

GFP tag inserted into endogenous lpin-1 locus. The strain was generated by using 5' attgttgctggcatcaaaaa crRNA for C-terminal lpin-1 editing and using dpy-10 editing as a co-conversion marker, followed by outcrossing twice to ABR lab stock of N2 to eliminate the dpy-10 co-conversion marker. Reference: Papsdorf et al, Nature Cell Biology, 2023, PMID 37127715. [NOTE: This strain was incorrectly named WBM1369 lpin-1(sta10[lpin-1::GFP]) in an earlier version of the paper.]

staEx4 [T20F7.6p(R81Q)::T20F7.6 + pha-1(+)]. Constitutively active T20f7.6 promoter construct (CA3). Maintain at 25 degrees. Superficially wild-type with increased lifespan and stress resistance. Reference: Greer EL et al Curr Biol 2007 Oct 9;17(19):1646-56.

staIs1 [pie-1p::GFP + unc-119(+)]. Superficially wild-type. Maintain under normal conditions. Reference: This strain was used as the empty vector control in Greer EL et al Nature 2010 doi: 10.1038/nature09195.

staIs2 [pie-1p::rbr-2::GFP + unc-119(+)]. Extended longevity. Maintain under normal conditions. Reference: This strain was used as LC Ppie-1::rbr-2::GFP (#3) in Greer EL et al Nature 2010 doi: 10.1038/nature09195.

Reduced lifespan. Maintain under normal conditions. The parental rbr-2 strain was outcrossed 6x and the parental set-2 strain was outcrossed 2x. Reference: Greer EL et al Nature (2010) doi: 10.1038/nature09195.

Derived by outcrossing parental strain RB2429 six times to N2, followed by recombining flanking chromosome to the right and left by recombining on, and then off rol-4(sc8) and unc-76(e911). Reference: Hale VA, et al. Genetics. 2012 Mar; 190(3): 1043-1057.

Heterozygous. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm4743 homozygotes (Egl, Mel, adult-onset sterility). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Only heterozygous animals should propagate. aph-1(tm4743) deletion allele was generated by the National BioResource Project of Japan, part of the International C. elegans Gene Knockout Consortium. Reference: Brinkley DM, et al. Genetics. 2024 Jul 8;227(3):iyae076. doi: 10.1093/genetics/iyae076. PMID: 38717968.

Heterozygous. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm4743 homozygotes (Egl, Mel, but do not display adult-onset sterility). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Only heterozygous animals should propagate. aph-2(tm6471) deletion allele was generated by the National BioResource Project of Japan, part of the International C. elegans Gene Knockout Consortium. Reference: Brinkley DM, et al. Genetics. 2024 Jul 8;227(3):iyae076. doi: 10.1093/genetics/iyae076. PMID: 38717968.

Temperature sensitive sterile. Maintain at 20C. Fertility is <10% of WT at 25C.

asEx83 [spe-19(+) + myo-3p::GFP]. Pick GFP+ to maintain. asEx83 contains 7.3kb genomic fragment including spe-19 (Y113G7A.10) and 850bp of upstream sequence. Transgene rescues spe-19(eb52) sperm activation defect. GFP+ hermaphrodites are fertile. non-GFP hermaphrodites are sterile. All males are fertile.

Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1508 ok1781 homozygotes (maternal sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Parry JM, et al 2009 Current Biology 19(20):1752-7.

Him. Temperature-sensitive sterile. Small brood size even at permissive temperatures; pick fertile animals and maintain at 15C. Worms lacking spe-45 function produce morphologically normal and motile sperm that cannot fuse with oocytes despite direct contact in the reproductive tract. spe-45 hermaphrodites and males are subfertile at 16C and sterile at 25C. Reference: Singaravelu G, et al. Current Biology 2015. http://dx.doi.org/10.1016/j.cub.2015.10.055

aeaIs10 [rgef-1p::GCaMP6s::3xNLS + lin-15(+)]. Worms express GCaMP6s in all neuronal nuclei. Pan-neuronal imaging strain; suitable for rapid whole-brain imaging due to brightness, good signal to noise ratio, and relative resistance to photo-bleaching. Reference: Susoy V, et al. Cell. 2021 Sep 30;184(20):5122-5137.e17. PMID: 34534446

Isolated in Memorial Park in Madison, WI. No hermaphrodites. Lots of SDS resistant dauers. Can survive between 15-28C, but grows very slowly at 15C.

Panagrolaimidae: P. rigidus (Schneider, 1866). Dig themselves into the agar. [NOTE: (1/12/2026) A user reports that this strain might be incorrectly classified as it is morphologically and behaviorally different from other Panagrolaimus strains.]

Isolated in Towers Hill State Park in WI. Males are rare. No SDS resistant dauers. Animals are osmosensitive, can be dried competely and recover in water. Rhabditidae. Previously known as Rhabditis sp.

Isolated in Pennsylvania. SDS resistant dauers. Males are rare.

Mesorhabditis spiculigera. Isolated in Pennsylvania. NOTE: (06/10/2016) AF72 was originally described as Mesorhabditis miotki, but K. Kiontke has determined through morphological inspection that this is actually a strain of Mesorhabditis spiculigera.

Rhabditidae: Mesorhabditis sp. Isolated in Governor Dodge State Park in South Dakota. Dark in color.

Isolated at Niagara Falls in Canada. SDS resistant dauers look like C. elegans predauers. Males are rare.

Neodiplogasteridae: Pristionchus Iheritieri, Maupas, 1919. Isolated in Ontario, Canada. [9/98: Ralf Sommer has found this strain to be hermaphroditic. He had successful matings between AF8130 and PS312 Pristionchus pacificus, indicating that AF8130 is probably P. pacificus.]

Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Shift L4s to 25C overnight to observe mutant phenotype of embryos produced by adults. Mutants lack a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). This strain can be used for CRISPR-Cas9 co-conversion. There is a causal mis-sense mutation present in zen-4(cle5), GAC to AAC (D520N), and one silent mutation, GCA to GCT at codon 519, that introduces an AluI site for RFLP analysis. A previous deposited version of this strain, zen-4(ok153), possessed two mis-sense mutations: GAC to AAC (D520N) and GAT to AAT (D735N). Reference: Farboud B, et al. Genetics Early online November 30, 2018; https://doi.org/10.1534/genetics.118.301775.

Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Shift L4s to 25C overnight to observe mutant phenotype of embryos produced by adults. Mutants lack a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). This strain can be used for CRISPR-Cas9 co-conversion. There is a causal mis-sense mutation present in zen-4(cle10), GAC to AAC (D520N), and two silent mutations. One silent mutation is a CGA to CGG mutation at codon 523 that creates a recognition site for a Cas9 guide RNA, in order to use zen-4(cle10ts) as a CRISPR/Cas9 co-conversion marker. The other silent mutation is a GCA to GCT mutation at codon 519 that introduces an AluI site for RFLP analysis. Reference: Farboud B, et al. Genetics Early online November 30, 2018; https://doi.org/10.1534/genetics.118.301775.

Heterozygotes are WT and segregate WT, UncBli, and Steriles which have an everted vulva. ar104 previously called evl-22 and mat-2.

Heterozygotes are WT and segregate WT, DpyUncs and adult steriles. Original deletion from Axys Pharmaceuticals.

Unc and Dpy. Not Blistered: dpy-10 suppresses the appearance of the blisters.

Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP tm2429 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. Reference: Jaramillo-Lambert A, et al. G3 (2015).

Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP tm1761 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. Reference: Jaramillo-Lambert A, et al. G3 (2015).

Homozygous viable, gfp expression in intestine, hypodermis, developing vulva, somatic gonad. Reference: Starich et al. eLife 2020;9:e58619. DOI: https://doi.org/10.7554/eLife.58619

Maintain at 15C. Temperature-sensitive dauer constitutive: 100% dauers at 25C, leaky at 20C. Dpy. Crowds.

xzEx1 [unc-54p::Dendra2]. Maintain at 15C; sterile at 25C. Pick animals with green fluorescence in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.

xzEx3 [unc-54p::UbG76V::Dendra2]. Maintain at 15C; sterile at 25C. Pick animals with green fluorescence in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.

uthEx649 [rpn-6p::tdTomato + rol-6(su1006)]. Temperature-sensitive. Maintain at 15C; sterile at 25C. Rollers. Pick rollers to maintain array. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.

uthEx649 [rpn-6p::tdTomato + rol-6(su1006)]. Temperature-sensitive. Maintain at 15C; sterile at 25C. Rollers. Pick rollers to maintain array. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.

rmIs110 [F25B3.3p::Q40::YFP]. uthEx557 [sur5p::rpn-6 + myo3p::GFP]. All animals will express YFP in nervous system; pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.

rmIs284 [F25B3.3p::Q67::YFP]. uthEx557 [sur-5p::rpn-6 + myo-3p::GFP]. All animals will express YFP in nervous system; pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.

rmIs110 [F25B3.3p::Q40::YFP]. uthEx633 [myo-3p::GFP]. All animals will express YFP in nervous system; pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.

rmIs284 [F25B3.3p::Q67::YFP]. uthEx633 [myo-3p::GFP]. All animals will express YFP in nervous system; pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.

uthEx633 [myo-3p::GFP]. Maintain at 15C; sterile at 25C. Pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.