Search Strains

opIs34 [hus-1p::hus-1::GFP + unc-119(+)]. Low-copy integrated array of 1144 bp hus-1 promoter and genomic coding sequence fused to GFP. Nuclear expression of GFP in germ cells and embryos. Integrated GFP construct completely rescues DNA damage induced cell cycle arrest defect and partially rescues DNA damage induced apoptosis of hus-1(op241).

opIs56 [egl-1p::2xNLS::GFP]. opIs56 is a low copy integrant of 3 kb 5' sequence from egl-1 fused to 2xNLS GFP. unc-119(ed3) should be outcrossed. Low basal GFP expression in embryos, meiotic germ cells and several neurons. GFP expression can be induced by ionizing radiation in all germ cells. Best viewed with dissected gonads.

opIs76 [cyb-1p::cyb-1::YFP + unc-119(+)]. The fusion protein partially rescues a cyb-1 null allele, so it is at least partially functional. non-Unc strain.

Maintain at 15 or 20C. Mrt at 25C. Defective for DNA damage induced germ cell death and cell cycle arrest.

Non-Glp; remains fertile even with sygl-1(RNAi). Endogenous lst-1 locus tagged with a 3xFLAG N-terminally. Visible in cytoplasm of 5-6 cell diameters of distal germline in young adults. Reference: Kocsisova Z, et al. Development. 2019 Apr 23;146(8).

Non-Glp; remains fertile even with lst-1(RNAi). Endogenous sygl-1 locus tagged with a 3xFLAG N-terminally. Visible in cytoplasm of 10-12 cell diameters of distal germline in young adults. Reference: Kocsisova Z, et al. Development. 2019 Apr 23;146(8).

ogEx49 [dyf-3(+) + rol-6(su1006)]. Maintain by picking Rollers. Animals which have lost the array are Dyf (DiI).

qaIs3502 [pie-1p::YFP::lmn-1 + pie-1p::CFP::H2B + unc-119(+)]. Relative stable expression of YFP::LMN-1 when grown at 24C. Expression of CFP::H2B is silenced. qaIs3502 is presumably not on LG III. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Commercial requests should be addressed to info@embl-em.de

qaEx3504 [pie-1::GFP::emr-1 + unc-119(+)]. Maintain by picking WT. Stable expression of GFP::EMR-1 when grown at 20C. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Commercial requests should be addressed to info@embl-em.de

qaIs3507 [pie-1p::GFP::lem-2 + unc-119(+)] WT. Stable expression of GFP::LEM-2 when grown at 20C. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Commercial requests should be addressed to info@embl-em.de

Heterozygotes are WT and GFP+ in the pharynx. ok487 homozygotes arrest as early larvae and are GFP-. qIs51 homozygotes are inviable.

qaIs8400 [let-858p::Ov-GST-3 + rol-6(su1006)]. Called AK1 in the reference article. The Ov-GST-3 gene was amplified from genomic DNA of O. volvulus with 1µM of the sequence specific primer 5'Klon and 3'Klon (5'Klon: 5'-GGCGTACGATGTCAAGATTTCCTCAACAAG-3'; 3'Klon: 5'-GGTCTAGATTTATTTAGGAATGATTGAATCGGTCG-3'; representing bases 4 - 25 and the complementary sequence of bases 821 - 841 of the published Ov-GST-3 cDNA (AF203814); bold underlines indicate restriction sites for Pfl23II (SplI) and XbaI, respectively; dotted underline indicates the start codon for translation; italics indicates the conserved sequence for the polyadenylation signal for transgenic transcript processing; the 8 5'-nucleotides of primer 3'Klon and the fourteen 5'-nucleotides of primer 5'Klon do not correspond to the template and introduce the sequences to the amplicon), 200 µM of each deoxynucleotide (Gibco BRL) and 2.5 units of Taq polymerase (Gibco BRL). After an initial denaturation of 3 minutes at 93°C, 35 cycles of annealing at 55°C for 1 minute, synthesis at 72°C for 2 minutes and a 1 minute denaturation at 93°C were performed, followed by a final extension at 72°C for 5 minutes. The genomic Ov-GST-3 fragment obtained by PCR (see above) was ligated into the pGEM-T Easy vector (Promega) by TA-cloning, cleaved with the restriction enzymes Pfl23II (SplI) and XbaI (restriction sites introduced by the primer) and inserted between the unique Pfl23II (SplI) and XbaI sites of the vector pPD103.05 (kindly provided by A. Fire). The sequence of the genomic Ov-GST-3 fragment in the resulting plasmid pAK1 was confirmed by automated dye terminator, dideoxy sequencing (ABI Prism 377TM Sequencer, PE Applied Biosystems) using the PCR primers (see above). The pAK1 DNA was injected in combination with the marker plasmid pRF4 [rol-6(su1006)] into the gonads of N2 C. elegans at a concentration of approximately 100 ng/µl for each plasmid. Transgenic worms were identified by the selectable Roller marker phenotype and the stable transmitting line AK1ex (AK1 extrachromosomal) was established. Integration of the extrachromosomal arrays was achieved by irradiation of AK1ex worms with 3600 rad (1 rad = 0.01 Gy) of x-rays (x-ray chamber: RUM 9421-070-77002, Philips, Netherlands; dosimeter: PTW-SN4, PTW, Germany). The progeny of these worms was then screened for 100% transmittance of the Roller phenotype to obtain the C. elegans line AK1int (AK1 integrated) with the chromosomally integrated transgenes.

pkIs2170 [hsp-16.41::ATG-LacZ(first 251nt)-I-Sce-I site-stops-LacZ + unc-119(+)]. pkIs2379 [hsp-16.41::I-Sce-I ORF + rol-6(su1006)]. Reference: Pontier DB &Tijsterman M. Nat Methods. 2009 Sep;6(9):655-7.

Maintain at 20C for best fecundity and most rapid development. Variable temperature-sensitive phenotypes. 20C: wild type; 22C: hypoxia resistant and long lifespan; 25C fully penetrant L3 developmental arrest. daf-15(bgg95) is an engineered I1033K missense mutation that also introduced three silent wobble mutations in nearby bases affecting restriction sites (cagGTTGCCCGAATGGCTCAAAAAATAGTGCAT -> cagGTGGCACGGATGGCTCAAAAAAAAGTGCAT). Strain can be genotyped by digest with either Bcc1 (silent wobble mutation generates additional cut in bgg95) or with Bgl1 (silent wobble mutation eliminates cut in bgg95). daf-15 crRNA: aucucgucagguugcccgaa. Repair ssODN: CATTTCGGGCATTCCTGCTTCGACGCGATGCACTTTTTTTTGAGCCATCCGTGCCACCTGACGAGATGTATTGGTTGTATTACACAGAC. Reference: Sun CL, et al. Curr Biol. 2025 Jun 9;35(11):2567-2582.e5. doi: 10.1016/j.cub.2025.04.040. PMID: 40339571.

Male-female strain. Isolated in July 2008 in Raliegh, NC in vermicompost by Yasmin Cardoza. Isolated from Galleria mellonella (great wax moth). It can be maintained at 20C. Called Ral4a.

mIn1 carries a GFP marker. Heterozygotes are GFP+ and segregate heterozygotes (wild-type GFP+), mIn1 homozygotes (Dpy GFP+) and vr6 homozygotes (GFP- and arrest as L1/L2 larvae). Maintain by picking GFP+ and checking for proper segregation of progeny. Reference: Kudron et al. (2008) PLos Genet 4(8):e1000181.

vrEx6 [nst-1p::nst-1::GFP::nst-1 3' UTR + unc-119(+)]. Stable array; high transmission rate and low percentage of mosaicism. Maintain by picking wild-type. Reference: Kudron et al. (2008) PLos Genet 4(8):e1000181.

Slightly slow growth. Almost sterile at 25C. Grow at 15-20C.

Clumpy, pale and slightly small, tend to dig into plate. Daf-c at 27C. Do not distribute this strain; other labs should request it from the CGC.

Enhanced pathogen susceptibility. Egg laying in response to food is defective. Reference: Shivers RP et al., (2009) Cell Host Microbe 6:321-30.

qdEx4 [ges-1p::sek-1(cDNA)::GFP::unc-54-3' UTR + myo-2p::mStrawberry::unc-54-3' UTR]. Array rescues sek-1 in the intestine. References: Shivers RP, et al. Cell Host Microbe. 2009 Oct 22;6(4):321-30.

qdEx8 [unc-119p::sek-1(cDNA)::GFP::unc-54-3' UTR + myo-2p::mStrawberry::unc-54-3' UTR]. Array rescues sek-1 in neurons. References: Shivers RP, et al. Cell Host Microbe. 2009 Oct 22;6(4):321-30.

agIs219 [T24B8.5p::GFP::unc-54-3' UTR + ttx-3p::GFP::unc-54-3' UTR] III. Intestinal GFP expression from agIs219 is abolished by km25. References: Shivers RP, et al. PLoS Genet. 2010 Apr 1;6(4):e1000892. Shivers RP, et al. Cell Host Microbe. 2009 Oct 22;6(4):321-30.

agIs219 [T24B8.5p::GFP::unc-54-3' UTR + ttx-3p::GFP::unc-54-3' UTR] III. Enhanced susceptibility to pathogens. References: Shivers RP, et al. PLoS Genet. 2010 Apr 1;6(4):e1000892. Shivers RP, et al. Cell Host Microbe. 2009 Oct 22;6(4):321-30.

Homozygotes are viable and do not show any gross abnormalities. Grows normally at all temperatures. Deletion removes 1505 bp including the first 4 exons.

Healthy and fertile in standard lab conditions, but unable to adapt to 1% oxygen. When hif-1(+) animals are incubated in1% oxygen, >94% will complete embryogenesis and larval development. In contrast, hif-1(ia4) mutants exhibit 66% embryonic lethality and 9% larval lethality in 1% oxygen. The requirement of hif-1 is alleviated if the oxygen level is increased to 2%. The ia4 mutation is a 1231 bp deletion of the second, third, and fourth exons, which encode much of the helix-loop-helix and PAS domains. Analysis of ESTs suggests that there are at least 4 alternatively spliced hif-1 transcripts. The ia4 deletion introduces a frameshift and a premature stop in the three longest forms.

iaIs21 [gcy-35p::GFP + unc-119(+)]. gcy-35::GFP is expressed in fifteen neurons, all of which also express ahr-1: AQR, PQR, URXR/L, ALNL/R, BDUL/R, SDQL/R, PLML/R, AVM, and two neurons in the tail tentatively identified as PLNL/R. gcy-35::GFP is only transiently expressed in PLML/R during the first larval stage.

enIs59 [ced-1p::2xFYVE::GFP + unc-76(+)] I. ced-1p::2xFYVE::GFP is a phosphainositol PtdIns(3)P reporter expressed in engulfing cells for assaying cell corpse clearance and other membrane trafficking events. GFP expression from enIs59 is relatively low and causes the least deleterious effects to worm development. Reference: Lu N, et al. PLoS Biol. 2012 Jan;10(1):e1001245. PMID: 22272187

ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpEx4340 [nmr-1p::TeTx::wCherry + sra-11p::TeTx::wCherry + HygromycinR]. Animals carrying the array show additional red fluorescence in the head compared to those that have lost the array. Transgenic animals are severely Unc. RFP positive head neuron soma can be observed under V16 in older animals. Hygromycin can be used to select for hpEx4340 transgenic animals. Reference: Lu Y, et al. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. PMID: 36182701.

ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpEx4343 [acr-5p::TeTx::wCherry + unc-4p::TeTx::wCherry + HygromycinR]. Pick animals with wCherry expression in ventral cord neurons to maintain hpEx4343. Animals carrying the array show additional red fluorescence in the head compared to those that have lost the array. Animals carrying hpEx4343 rest as coilers strongly biased towards ventral bend as L1 larvae and are severely Unc as adults. Coiling is somewhat suppressed in the ljIs131 background, but animals still exhibit an obvious bias towards ventral bend during movement. Hygromycin can be used to select for hpEx4343 transgenic animals. Reference: Lu Y, et al. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. PMID: 36182701.

hpIs860 [twk-40p(short)::eGFP + myo-2p::wCherry]. Cytosolic GFP expression in AVA, AVE & AVB in the head, with the strongest signal in AVA. Additional fluorescent signal in RVG (SAB) and tail (DVA).

hpIs860 [twk-40p(short)::eGFP + myo-2p::wCherry]. twk-40 gain-of-function allele. Paralyzed, no backward movement upon head touch. Cytosolic GFP expression in AVA, AVE & AVB in the head, with the strongest signal in AVA. Additional fluorescent signal in RVG (SAB) and tail (DVA).

hpIs860 [twk-40p(short)::eGFP + myo-2p::wCherry]. Loopy movement with increased reversals. Cytosolic GFP expression in AVA, AVE & AVB in the head, with the strongest signal in AVA. Additional fluorescent signal in RVG (SAB) and tail (DVA).

Egl. Backward stiff and slow moving. Sluggish. Can move fast when poked. Outer pairs: F59F5.6EL1 (TTGCATCTGCAAAAGAAACG); F59F5.6ER1 (GCTCCGAACGAAAGAAGTTG). Inner pairs: F59F5.6IL1 (AATCTCTAACCATGCGGTCG); F59F5.6IR1 (CGCGGGAATTATGCCTATTA).

Fainter. hp428 is a G to A substitution that alters the 3′ splice junction of the first intron resulting in a single base pair deletion in the hp428 cDNA causing a frame-shift and premature stop. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. doi: 10.1016/j.neuron.2013.01.018. PMID: 23522043.

hp684(Q1864X) mutant animals generate reversal movement with little flexing of the posterior body, and the stiffness is prominent during prolonged reversals. This phenotype is progressive, and most prominent when animals develop from the L4 stage larvae into adults. Reference: Chitturi JH, et al. PLoS Genetics. 2018;14(4):e1007303.

Heterozygotes are WT. drh-3 homozygotes are sterile. the fj52 mutation deletes a 405 bp region including the promoter, the first exon and half of the second exon. The deletion can be checked by PCR with the following primers: TTTATTGATTCCGCCGTTGCTC and TGCAGCTCCAGCCACTCTATCA. The fj52 mutation was isolated from a deletion mutant libray of the K. Nishiwaki group. Homozygous hT2[bli-4 let-? qIs48] inviable.

Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. The fj54 mutation deletes a 524 bp region including half of the second exon, the third exon, and almost all of the fourth exon, causing a frame shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA.

Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj67) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Intracellular localization of CSR-1 is abnormal in the csr-1(fj67) homozygotes. fj67 is a 60-bp in-frame deletion of the first lysine-rich region (KQKDNFILLDILLKQWAAKK) in CSR-1. The first lysine-rich region in the WT has a FokI site. The deletion can be checked by PCR with the following primers: CACCTGTGATTTTTCGGGGAAC and TGGATTCCTTTTGCTGCAACAG, followed by digestion with FokI. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

ljIs123 [mec-4p::ChR2(H134R)::YFP(codon-optimized) + unc-122p::RFP]. zxEx621 [glr-1p::Mac::mCherry + elt-2p::GFP]. Pick animals with robust GFP expression in intestinal nuclei to maintain.

daf-d. Strong heterochronic phenotypes in seam, somatic gonad, intestine. Class I allele. Occasional abnormal dauers under exhausted conditions.

Weak heterochronic phenotypes in seam, intestine, somatic gonad. Class V allele.

daf-d. Weak heterochronic phenotypes in seam, somatic gonad and intestine. Class III allele.

Mig on low cholesterol. Single daf-c at 27C, weak Mig. Strong expression in intestine at all stages. Grow at 20C.

daf-d. Strong heterochronic phenotypes in seam, somatic gonad, intestine. Class I allele.

Precocious fusion of seam cells one stage earlier (prior to L3 molt); impenetrant gonadal migration defects; SynMig on daf-12 RNAi.

daf-d. Strong heterochronic phenotypes in seam, somatic gonad, intestine. Class I allele.

Gonadal lead cell Mig. Weak heterochronic phenotype in intestine. Weakly daf-c at 25C. Class V allele.

daf-d. Strong heterochronic phenotypes in seam and intestine. Weak heterochronic phenotypes in somatic gonad. Class II allele.

Strong heterochronic phenotypes in seam, somatic gonad, and intestine. Weakly daf-c at 15C. Class IV allele.