Search Strains

snt-1 encodes the C. elegans homolog of synaptotagmin I. md290 is a deletion that removes most of the coding sequence. Strain is a slow growing aldicarb resistant (Ric) Unc. Males won't mate.

jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope. Heterozygotes are GFP+ in the pharynx. dhc-1 homozygotes are GFP- and sterile or partially sterile pvuls. Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP js121 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.

Ric; very slightly slow and loopy movement. Aberrant EPG.

Ric; very slightly slow and loopy movement. Aberrant EPG.

jsIs682 [rab-3p::GFP::rab-3 + lin-15(+)]. Expresses rab-3::GFP in most, if not all, neurons. rab-3::GFP is localized primarily to synaptic regions.

Superficially wild-type. Maintain under normal conditions. Reference: Deke SL, et al., J Neurosci. 2005 Jun 22;25(25):5975-83.

Aex and aldicarb resistant.

Superficially wild-type. Maintain under normal conditions. Reference: Deke SL, et al., J Neurosci. 2005 Jun 22;25(25):5975-83.

nuIs11 [osm-10::GFP + lin-15(+)]. Array contains pool28; KP#57-59 (osm-10::GFP insert at Nrul site) and pJM24 [lin-15(+) rescues n765 at 20C]. GFP expressed in ASH, ASI, PHA and PHB after 3-fold. nuIs11 may be inserted on LG I.

Reference: Ortiz CO, et al., Curr Biol. 2009 Jun 23;19(12):996-1004.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Most progeny shifted to 26C form dauers. Some dauer formation at 20C.

syEx475 [myo-3p::unc-68(see following comments) + myo-2p::GFP + pUC-19]. Pick GFP+ animals to maintain. myo-3p::unc-68 transgene was produced by injecting pEM23 (myo-3 promoter + unc-68 exons 1-8) + 18 kb unc-86 PCR fragment (start codon through nucleotide 18090) + pLM511 (unc-68 position 11989 to the end); fragments were recombined in vivo.

syIs243 [myo-3p::TOM20::mRFP + unc-119(+) + pBS Sk+]. Integrated from PS6053. Strain has been outcrossed, but not known if unc-119 mutation is still present in the background.

Superficially wild-type. Reduced dauer formation in response to specific ascarosides. Reference: Kim K, et al. Science. 2009 Nov 13;326(5955):994-8.

Increased lethality and male frequency. Synthetic lethal with helq-1(tm2134). Sensitive to camptothecin. Interacts with rip-1 and rfs-1. Reference: McClendon TB, et al. Genetics. 2016 May;203(1):133-45.

Large yolk platelets in oocytes. Premature yolk degradation in embryos. Large endosomes in coelomocytes and intestine. Reference: Chotard L, et al. Mol Biol Cell. 2010 Jul 1;21(13):2285-96.

vhIs12 [vha-6p::GFP::tbc-2 + Cbr-unc-119(+)] II.  vhIs12 is inserted to the left of tbc-2(m2241) in LG II. GFP::TBC-2 rescues the large endosome phenotype in the intestine of tbc-2(tm2241) animals. Outside the intestine, tbc-2(tm2241) animals have large yolk platelets in the oocytes and early embryos that are not rescued.

M28.8. Homozygous. Outer Left Sequence: AACTCCAGCTCGCAATGAAT. Outer Right Sequence: GCCAAGGTTTGCAAGTTTGT. Inner Left Sequence: TGTGCTCAGTATTCGGGATCT. Inner Right Sequence: ACAAACCGACAGATTTGCCT. Inner Primer PCR Length: 3039 bp. Deletion Size: 2145 bp. Deletion left flank: TGAACCTCTTTGTTTGTTCTTATCAATTTA. Deletion right flank: TTAATATCGGGTAAGACAAATTAGTGTGAT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M28.4 Homozygous. Outer Left Sequence: agcgattccaaaatcactgg. Outer Right Sequence: tgcctggtaggcagaaaagt. Inner Left Sequence: cgctggattgttggttatca. Inner Right Sequence: gtcattggaattggaggtgg. Inner Primer PCR Length: 3023. Deletion size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M28.9 Homozygous. Outer Left Sequence: gaaacccgaaccatctgaaa. Outer Right Sequence: agcactgcggaaggtagtgt. Inner Left Sequence: gcttcatagccctgatctcg. Inner Right Sequence: aaattccccaaaatcgaagg. Inner Primer PCR Length: 1142. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M28.2 Homozygous. Outer Left Sequence: actgccctggttttggtaaa. Outer Right Sequence: atcttcaattcccggttgtg. Inner Left Sequence: tccttcacctcgattgcttt. Inner Right Sequence: ccaaagttttgtaattttcttccaa. Inner Primer PCR Length: 1146. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M28.7. Homozygous. Outer Left Sequence: ATCGTCAGCTCGCAGAATTT. Outer Right Sequence: TGCCAGGAATTGCATAGACA. Inner Left Sequence: TCGATGAGGCTGTGATTCTG. Inner Right Sequence: TATCTGCCTTATGCCTGGCT. Inner primer WT PCR product: 2912. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Small, coily Unc; aldicarb resistant. 780-bp deletion: TTCGGTTCGTGTTTTTTATTGATATTTTTT /-----/ACAACATCCATTCGTCACAAGCTGCTATCA. Reference: Loria PM, et al., Curr Biol. 2003 Aug 5;13(15):1317-23.

Poor growth and fertility at 25C. Grows well at 20C and is more fertile than ric-8(md303). Degree of aldicarb resistance is similar to md303 but locomotion rate is greater than md303 and embryonic lethality is only 19%, versus 29% for md303. Contains a Tc1 transposon insertion in the middle of the ric-8 coding sequence.

Egl. Ric. Reduced locomotion and pharyngeal pumping. Reduced body flexion at rest, but loopy backing.

Heterozygotes are WT and segregate WT, hT1 homozygotes (mid-larval lethals), md2415 homozygotes (generally L1 lethals which are almost completely paralyzed and have a coily posture with some head movement), and dead eggs. md2415 has a 2.7 kb deletion in the "unc-13R" region.

Canonical allele. Superficially wild-type. Frequency of spontaneous reversals approximately twice that of wild type. Initial L4 swimming rate approximately half that of wild type, and decreases steadily for 30 min, until the animals are immobile. Synthetic lethal with pmt-2 RNAi.

Cosmid coordinates (with respect to T23G5): 24967-26802 (or 24965-26800, or 24966-26801, or 24968-26803, or 24969-26804 - note that each deletion endpoint lies within a TATA sequence so there is some ambiguity in the precise endpoints). Flanking sequences: CTATTCGGATATCTTGCCAATGCTA//TAGGAATTATTTTTGCGCTCTCAGG. Deletion size: 1836 bp.

Superficially wild-type growth and behavior. unc-25-dependent aldicarb resistance. unc-25-dependent phenotypes are not rescued by exogenous GABA. Molecular details: 1491-bp deletion, removes exon 3, exon 4, and most of exon 5. Flanking sequences: AAAACTTCCACCAAGCACTT/ /AATTATATAACTATGTCACA Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30.

Superficially similar to unc-25 mutants (Shrinker, Exp, etc.), except that unc-25-dependent behaviors are not rescued by exogenous GABA. Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30.

Superficially similar to unc-25 mutants (Shrinker, Exp, etc.). GABA-dependent phenotypes are rescued by exogenous GABA. Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30. Peden AS, et al. Nat Neurosci. 2013 Dec;16(12):1794-801.

Superficially the same as unc-25 mutants (Shrinker, Exp, etc.). Exogenous GABA does not rescue the unc-25-dependent expulsion deficit. See Mullen GP, et al. [Mol Biol Cell. 2006 Jul;17(7):3021-30.] for detailed description of snf-11 and unc-25; snf-11 phenotypes. See Peden AS, et al. [Nat Neurosci. 2013 Dec;16(12):1794-801]. for detailed description of snf-3 phenotypes.

Superficially wild-type. Exogenous GABA does not rescue the unc-25-dependent expulsion deficit. See Mullen GP, et al. [Mol Biol Cell. 2006 Jul;17(7):3021-30.] for detailed description of snf-11 phenotypes. See Peden AS, et al. [Nat Neurosci. 2013 Dec;16(12):1794-801]. for detailed description of snf-3 phenotypes.

Knock-out allele ok237 is a large (2229-bp) deletion. Coordinates: leftmost deleted base = 35441 of K02G10; rightmost deleted base = 296 of F55D10. ok237 eliminates almost all of K02G10.8 (dnj-14) and also the 5'-part of F55D10.3 (glit-1, encodes a homolog of gliotactin), as well as the presumed promoter regions between the 2 genes. In addition, F55D10.3 could be the first member of an operon, with F55D10.2 (aka rpl25.1, which encodes a ribosomal protein) as the second member of the operon. The deletion is likely to eliminate the expression of 2 or 3 genes, not just dnj-14.

Multigenic deletion that removes the promoter and open reading frame of unc-18. Unc.

Heterozygotes are wild-type with pharyngeal-expressed GFP, and segregate wild-type GFP+(pharynx) heterozygotes, arrested nT1[qIs51] homozygotes, and viable non-GFP(pharynx) rad-51(iow53[GFP::rad-51]) homozygotes. Balancer is prone to breaking down. If a population contains a mix of bright and dim GFP animals, pick dim GFP and check for correct segregation of progeny to maintain. iow53 inserted a GFP tag at the N-terminus of the endogenous rad-51 locus, but the tagged protein is not fully functional. non-GFP(pharynx) rad-51(iow53[GFP::rad-51]) homozygotes form GFP foci in the germline that are mostly spo-11 dependent, and GFP::rad-51 homozygotes have defects in unloading RAD-51. Created by CRISPR using pDD282, therefore may also contain 3XFLAG. Reference: Koury E, et al. Nucleic Acids Res. 2018 Jan 25;46(2):748-764.

Homozygous gfp and 3xflag C’ terminal tag inserting just before the STOP codon of mre-11. The strain is fertile and contains wild type germline (examined by DAPI). GFP is expressed in all germline nuclei. Maintain the strain by picking worms at 20C, no selection required. gfp::3xflag was added by CRISPR/Cas9 using pDD282-based vector. Reference: Reichman R, et al. Genetics. 2018 Apr;208(4):1421-1441.

Heterozygotes are wild-type with pharyngeal-expressed GFP, and segregate wild-type GFP+(pharynx) heterozygotes, arrested nT1[qIs51] homozygotes, and viable non-GFP(pharynx) ubc-9(iow97[3xFLAG::ubc-9]) homozygotes. Maintain the strain by picking wild-type GFP+ worms and checking for correct segregation of progeny. iow97 was created by CRISPR/Cas9 insertion of a 3xflag tag at the N-terminus of the endogenous ubc-9 locus; however, the tagged protein is not fully functional. SSM491 is a replacement for SSM291: analysis shows that in all parameters tested, SSM491 is identical to SSM291, which was genetically unstable and prone to breaking down. Reference: Reichman R, et al. Genetics. 2018 Apr;208(4):1421-1441.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

Reference: Bailly AP, et al. PLoS Genet. 2010 Jul 15;6(7):e1001025. Agostinho A, et al. PLos Genetics 2013.

Reference: Agostinho A, et al. PLos Genetics 2013.