Strain Information
| Name | RM2005 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | unc-75(md1344) I. |
| Description | Small, coily Unc; aldicarb resistant. 780-bp deletion: TTCGGTTCGTGTTTTTTATTGATATTTTTT /-----/ACAACATCCATTCGTCACAAGCTGCTATCA. Reference: Loria PM, et al., Curr Biol. 2003 Aug 5;13(15):1317-23. |
| Mutagen | N/A |
| Outcrossed | x7 |
| Made by | Jim Rand |
| Laboratory | RM |
| Reference | Loria, P.M., Duke, A., Rand, J. B., and Hobert, O., 2003. Two neuronal, nuclear-localized RNA binding proteins involved in synaptic transmission. Current Biology 13:1317-1323. |
Sign in
or
register an account if you want to order this strain.