Search Strains

jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. ngEx1[ceh-16::GFP]. ngEx1 rescues ceh-16(lg16) lethality. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Cassata et al. Development. 2005 Feb;132(4):739-49.

byEx655 [pink-1p::pink-1::GFP + myo-2p::mCherry + herring sperm DNA]. Pick mCherry+ animals to maintain. pink-1 translational GFP (C-terminal GFP) fusion generated by cloning the complete pink-1 genomic fragment (3191 bp) with a 6-kb upstream promoter region and into pPD117.01. Reference: Sämann J, et al. J Biol Chem. 2009 Jun 12;284(24):16482-91.

zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)] IV. Tumorous germline with degeneration of surrounding extracellular matrix & disrupted gonadal basement membrane. Reference: Qi W, et al. PLoS Genet. 2012;8(8):e1002836. doi: 10.1371/journal.pgen.1002836.

byIs161 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. Pan-neuronal over-expression of the F3 pro aggregation fragment of the human Tau protein with K280 deleted (line A). Integration site not mapped. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.

byIs162 [rab-3p::F3(delta)K280 I277P I380P + myo-2p::mCherry]. Pan-neuronal over-expression of the F3 pro aggregation fragment of the human Tau protein with K280 deleted and two isoleucines to proline substitutions in the hexapeptide motifs of the repeat region (line A). These mutations abrogate the aggregation, making this strain an anti-aggregation control for BR5270. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.

byIs162 [rab-3p::F3(delta)K280(I277P)(I308P) + myo-2p::mCherry]. bkIs10 [aex-3p::h4R1NtauV337M + myo-2p::GFP]. Strain co-expressing the F3(delta)K280 anti-aggregation Tau fragment (with two I to P substitutions) and full-length Tau in all neurons. Red and green fluorescence in the pharynx due to the co-injection markers. The F3/2P fragment is not able to nucleate aggregation of full length Tau. bkIs10 contains an integrated transgene encoding the 1N4R isoforms of human tau with the 337M FTDP-17 mutation. Expression is driven by the pan-neuronal promoter aex-3. Over-expression of this transgene results in a pronounced Unc phenotype. Reference: Fatouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.

byEx836 [odr-4p::tax-4::GFP + myo-2p::mCherry]. Pick mCherry+ animals to maintain. Rescues tax-4 null mutant. Expresses tax-4(+) in AWA, AWB, AWC, ADF, ASG, ASH, ASI, ASJ, ASK, ADL, PHA, and PHB sensory neurons, but not AFD sensory neurons. Reference: Liu S, Schulze E, Baumeister R. PLoS One. 2012;7(3):e32360.

byIs193 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. bkIs10 [aex-3p::hTau V337M + myo-2p::GFP]. Worms have severe locomotion defect and slow growth. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.

byIs193 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. F3 pro aggregation fragment is expressed at low levels (line B); hard to detect by western blot. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.

byIs194 [rab-3p::F3(delta)K280 I277P I380P + myo-2p::mCherry]. bkIs10 [aex-3p::hTau V337M + myo-2p::GFP]. Tau anti-aggregation double transgenic line generated by crossing byIs194 x bkIs10. Normal locomotion. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.

byIs194 [rab-3p::F3(delta)K280 I277P I380P + myo-2p::mCherry]. Pan-neuronal over-expression of the F3 pro aggregation fragment of the human Tau protein with K280 deleted and two isoleucines to proline substitutions in the hexapeptide motifs of the repeat region (line B). These mutations abrogate the aggregation, making this strain an anti-aggregation control for BR5270. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.

byIs161 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. bkIs10 [aex-3p::h4R1NtauV337M + myo-2p::GFP]. Strain co-expressing the F3(delta)K280 pro-aggregation Tau fragment and full-length Tau in all neurons. Worms have severe locomotion defect and slow growth. Red and green fluorescence in the pharynx due to the co-injection markers. bkIs10 contains an integrated transgene encoding the 1N4R isoforms of human tau with the 337M FTDP-17 mutation. Expression is driven by the pan-neuronal promoter aex-3. Over-expression of this transgene results in a pronounced Unc phenotype. Derived by additional outcrossing of BR5485. Reference: Fatouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.

antIs30 [attP-f + Cbr-unc-119(+) + glh-2p::phiC31 + rol-6(partial) + myo-2p::GFP + attP-r] II. antIs30 was inserted into ttTi5605 on LG II using MosSCI. GFP expression in pharynx is very weak (as it is single copy) and is easiest to see during the L1-L3 stages. This strain contains a phiC31 docking site and can be used for precise single-copy integration of transgenes via recombination mediated cassette exchange. The docking site contains inverted phiC31-attP sites flanking phiC31 integrase expressed from the glh-2 germline promoter. Integration constructs need to have inverted phiC31-attB sites that flank the intended sequence to be inserted. Reference: Yang FJ, et al. "phiC31 integrase for recombination mediated single copy insertion and genome manipulation in C. elegans." Genetics 2021.

antIs31 [attP-f + Cbr-unc-119(ant40) + glh-2p::phiC31 + rol-6(partial) + myo-2p::GFP + attP-r] II. Unc. antIS31 has been found to self-excise; check for GFP expression periodically to retain the insertion. GFP expression in pharynx is very weak (as it is in single copy) and is easiest to see during the L1-L3 stages. This strain contains a phiC31 docking site and can be used for precise single-copy integration of transgenes via recombination mediated cassette exchange. The docking site contains inverted phiC31-attP sites flanking phiC31 integrase expressed from the glh-2 germline promoter. Integration constructs need to have inverted phiC31-attB sites that flank the intended sequence to be inserted. antIs31 was derived by CRISPR/Cas9 knockout of Cbr-unc-119 in antIs30 creating ant40, a 691 bp deletion in Cbr-unc-119. Because antIs31 does not rescue unc-119(ed3), BRC566 facilitates the use of Unc-119 rescue as a selection marker for transgene insertions. Reference: Yang FJ, et al. "phiC31 integrase for recombination mediated single copy insertion and genome manipulation in C. elegans." Genetics 2021.

F42G8.4. No obvious phenotype. Follow by PCR. Predicted gene is a p38 related Map Kinase. Approx. 1.5 kb deletion by agarose gel (not sequenced so end points not known). Nested PCR primers for detecting F42G8.4: F42G8.4EL1 5' - TCGCCCTTTGTATGTCTTCC - 3'. F42G8.4ER1 5' - TTCTCCAGGGATTAACGGTG - 3'. F42G8.4IL1 5' - TTTTCACTGCGTCTCAATCG - 3'. F42G8.4IR1 5' - TTTCAAATTTGCAGGTGTGC - 3'.

ieSi64 [gld-1p::TIR1::mRuby::gld-1 3'UTR + Cbr-unc-119(+)] II. Essentially wild-type when maintained on NGM plates. All germline stem cells enter into meiosis when treated with Auxin (1mM). References: Chen J, et al. PLoS Genet. 2020 Mar 20;16(3):e1008650. PMID: 32196486. Chen J, et al. 2020 MicroPublication (https://doi.org/10.17912/micropub.biology.000310) .

kqEx73 [pat-3(sp) + rab-3::RFP + cki-1::GFP]. Pick RFP+ to maintain. kqEx73 carries a form of pat-3 gene with splicing defects; rescues pat-3 null allele. pat-3(sp) is a frameshift mutation in the splice acceptor region (ag to aa) that abolishes conserved interaction domains such as the NPxY motifs and creates a splice variant with an extra 19 amino acids. The pat-3(sp) animals not only produce mutant pat-3, but also express the regular splice form due to utilization of an unusual splice acceptor. Abnormal Distal Tip Cell migration and pat-3 gene splicing (intron 7) defects. Reference: Kihira S, et al. PLoS One. 2012;7(8):e42425.

Mild motility and gonad migration defects. pat-3(kq8041) is an engineered Y804A substitution of the membrane distal tyrosine in the cytoplasmic domain. Reference: Hanna J, et al., microPublication Biology. 10.17912/micropub.biology.000291. https://www.micropublication.org/journals/biology/micropub-biology-000291

Motility and cell (DTC) migration defects. pat-3(kq8042) is an engineered Y804E substitution of the membrane distal tyrosine in the cytoplasmic domain. Reference: Hanna J, et al., microPublication Biology. 10.17912/micropub.biology.000291. https://www.micropublication.org/journals/biology/micropub-biology-000291

Mild motility and cell migration defects. pat-3(kq8043) is an engineered Y804F substitution of the membrane distal tyrosine in the cytoplasmic domain. Reference: Hanna J, et al., microPublication Biology. 10.17912/micropub.biology.000291. https://www.micropublication.org/journals/biology/micropub-biology-000291

Maintain by picking Lon non-Unc. Throws Lon non-Unc, Lon Unc Vab (bent head, tails very thin), and Lon Unc Mel (kinker, temperature-sterile).

Animals with the duplication are WT. Animals without the duplication are Nob (NO Back end; 100% lethal). Pick wild-type to maintain; typically segregates about 50% wild type progeny and 50% Nob larvae.

Animals with the duplication are WT. Animals without the duplication are Nob (NO Back end; 100% lethal). Pick wild-type to maintain. The Dpy and Unc phenotypes are not visible in the Nob background. ct223 is recessive.

Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct281 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct281 is a 4.7kb deletion removing intron 5, exon 6, and the 3'UTR of the pal-1 gene. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.

Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct224 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct224 is a 4.2kb deletion removing exon 1 through exon 6 of the pal-1 gene. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.

WT hermaphrodites that segregate WT, Dpy Steriles and Nob larvae. The Nob phenotype results in 100% lethality. Maintain by picking WT.

Animals with the duplication are WT. Animals without the duplication are Nob (NO Back end; 100% lethal). Pick wild-type to maintain; segregates wild type progeny, Nob larvae, and occasional dead eggs. ct351 is recessive.

ctIs33 [pal-1::GFP + rol-6(su1006)]. Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct224 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct224 is a 4.2kb deletion removing exon 1 through exon 6 of the pal-1 gene. ctIs33 carries a non-rescuing pal-1::GFP fusion containing ~7kb 5' of the SL1 splice site through part of exon 5 fused to GFP. GFP expression is primarily embryonic and limited to a few cells; not visible except at high magnification. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.

ctIs39 [hbl-1p::GFP::NLS::hbl-1 3'UTR + rol-6(su1006)]. Rollers. Reporter encodes the first 133 amino acids of HBL-1 followed by GFP with SV40 NLS and 1.4 kb of hbl-1 3' UTR. Reference: Fay DS, et al. Dev Biol. 1999 Jan 15;205(2):240-53.

svDp1 [sur-5::GFP] (III;f). svDp1 was derived by insertion of a sur-5::GFP marker into sDp3(III;f). Pick GFP+ wild-type to maintain. svDp1 rescues ct224. ct224 homozygotes (lacking GFP expression) show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. The duplication is lost in about 30-40% of embryos. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.

Deficient in synthesis of ether-linked lipids. Contains high content of saturated fatty acids. Reference: Shi X, et al. J Lipid Res. 2016 Feb;57(2):265-75.

waEx15 [fat-7::GFP + lin15(+)]. Maintain by picking non-Muv animals. These should be GFP+.

waEx16 [fat-6::GFP + lin15(+)]. Maintain by picking non-Muv animals. These should be GFP+.

waEx18 [fat-5::GFP + lin15(+)]. Maintain by picking non-Muv animals. These should be GFP+.

Deficient in synthesis of ether-linked lipids. Contains high content of saturated fatty acids. Reference: Shi X, et al. J Lipid Res. 2016 Feb;57(2):265-75.

Deficient in synthesis of ether-linked lipids. Contains high content of saturated fatty acids. Reference: Shi X, et al. J Lipid Res. 2016 Feb;57(2):265-75.

This strain is tolerant to acute treatment of ethanol. The severity and incidence of stress-induced tremors are greater than in wild-type. Reference: Jee C, et al. Genes Brain Behav. 2013 Mar;12(2):250-62.

Heterozygotes are Unc and segregate Uncs, dead eggs, and non-Uncs (dsb-1 homozygotes), which produce 99% inviable embryos due to meiotic nondisjunction. Pick Unc to maintain and check for correct segregation of progeny. we11 is a TCA to TAA nonsense mutation in the dsb-1 coding sequence that introduces a premature stop after leucine 96. Reference: Stamper EL, et al. PLoS Genet. 2013;9(8):e1003679.

meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.

Degenerate tail. Posterior half is thin, pale, uncoordinated.

Dauer defective. Notched head. Unlinked double. M-MATING-NO SUCCESS.

Notched head. M-MATING++++ >30%WT.

Blebs on tail of adult hermaphrodite. Tail irregular, tail cuticle sometimes separated, tail spike sometimes truncated. Some animals have enlarged excretory canals.

Unc. Tail abnormalities-twisted or knobbed. Recessive. M-MATING-NO SUCCESS.

Notched head. Penetrance <70%.

Lineage abnormal. Recessive. Segregates males. Males abnormal.

Segregates males. Males abnormal.

Dominant suppressor of Unc. Movement almost WT.

Lineage abnormal. Bursae abnormal. Segregates abnormal males. M-MATING-NO SUCCESS.