Search Strains

Vab. Notched Head. Distal tip cell Mig. Male tail ray and spicule defects. Males do not mate. About 50% larval lethality. H and B cell lineage defects. Received new stock Jan. 2006.

2505bp deletion in cosmid T07D1. Break points are 6562 and 9069 with respect to T07D1. Sequence at the break point is: GGAAAAAAAAACTTCGCG / TTTGGCTAGTCGTAT. Primers: ok296u1: CTGAAACCATCTGACAGA; ok296d1: CATCGGAATAGGATTGTTG; ok296d2: CATTAGGTTTACAGGCTTAG. ok296d1u1 = 290bp product with WT allele. ok296d2u1 = 352 bp product with ok296 allele.

1237bp deletion in cosmid F57F5. Break points are 743 and 1980 with respect to F57F5. Sequence at the break point is: TGAGAAGTTTATAAAAAAGTA / AAACTTAAGAGTTTTCAGTCA. Primers: ok232u1: GGATTGCTTACGTGCATC; ok232d1: ATTACATTTGCAGAAACTCG; ok232d2: CTCTTCTCACTCAAATGATG. ok232u1/d1 = 322bp product with WT allele. ok232d2/u1 = 397bp product with ok232 allele.

Low penetrance tail Vab and embryonic lethality.

Cold sensitive lethal. Vab at 20 and 25C.

vab-2(ju1) has embryonic lethality (12%) and notched heads (about 40%). vab-2(ju1) is considered a null allele (W30opal). pka efn-1.

Intermediate Vab-1 phenotype. About 9% embryonic lethality and about 20% larval lethality. CB699 outcrossed 2X to N2 to make CZ414.

Incompletely penetrant embryonic lethal at three-fold. Mild Mua. Abberant head epidermal morphology. PKA vab-21.

Temperature-sensitive. Maintain at 15C. Vab. Lethal at 25C. 2-fold Lpy. Reference: Woo WM, et al. Development. 2008 Aug;135(16):2747-56.

Low penetrance tail vab (3-5%). Low penetrance embryonic lethality (3-5%). Low penetrance larval lethality (3%).

mIs14 [myo-2::GFP + pes-10::GFP]. Homozygous lethal double mutant balanced by GFP- and dpy-10-marked inversion. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP homozygous vab-1 ptp-1 double mutants. vab-1 ptp-1 double mutants (non-GFP) are embryonic lethal. Reference: Harrington RJ, et al. Development. 2002 May;129(9):2141-53.

juEx1111 [spon-1::vGFP + ttx-3p::RFP]; rescues ju402 lethality. Vab. 2-fold Lpy. ju402 is lethal. Reference: Woo WM, et al. Development. 2008 Aug;135(16):2747-56.

vab-1 null phenotype. e2027 is a 74 bp deletion allele.

Impenetrant Vab - mostly tail; not mapped. Strain throws early larval lethals (ad1025 homozygotes) and Bli Uncs.

ad810 is homozygous lethal. ad810/+ is Egl and it suppresses gpb-2 (a.k.a. eat-11). In DA1077, heterozygotes are Egl. Strain throws Lon Males.

ad810 is homozygous lethal. ad810/+ is Egl and it suppresses gpb-2 (a.k.a. eat-11). In DA1096, heterozygotes are Egl. Throws Lon males.

Eat. Slow pumping. Long lived. Embryonic lethality observed in a significant fraction of animals is likely explained by a mutation in an essential gene linked to eat-2

Small intragenic deletion. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations.

Deletion of bp 1108-3194 of C31H5.3

Deletion of bp 433-1994 of K02F2.6.

F59C12.2. Homozygous. Outer Left Sequence: AAGCATCTTTGAGCGCATTT. Outer Right Sequence: CATAGCGAGTGTTTGGAGCA. Inner Left Sequence: AATTTCAGGGGTGTGGACAT. Inner Right Sequence: AATCATTTTTGAAACCGACCC. Inner Primer PCR Length: 2926 bp. Deletion Size: 859 bp. Deletion left flank: TGTTTTGTAAGCTTTGTAAAATTATGTAGT. Deletion right flank: CCACTAGAAATAATTTCCCCCTTCTTTTTC. URL: http://www.celeganskoconsortium.omrf.org.

Lack of 5HT stimulation of pumping. Primers GGCCTGCCTTCCTGACATGT, CGCGGATTCTCTATCAATAG, ATCCTG GAGCTGGCGAGTTA, GACTGTAAACGCGCAGAGTC. Mutation site 42634-42635 - GGGAANNAAAACCCTCCCTNNANNANNATNNGCANNCC - 43376-43377. 742 bp deletion + 38 bp insertion.

F59C12.2. Homozygous. Outer Left Sequence: AAGCATCTTTGAGCGCATTT. Outer Right Sequence: CATAGCGAGTGTTTGGAGCA. Inner Left Sequence: AATTTCAGGGGTGTGGACAT. Inner Right Sequence: AATCATTTTTGAAACCGACCC. Inner Primer PCR Length: 2926 bp. Deletion Size: 859 bp. Deletion left flank: TGTTTTGTAAGCTTTGTAAAATTATGTAGT. Deletion right flank: CCACTAGAAATAATTTCCCCCTTCTTTTTC. URL: http://www.celeganskoconsortium.omrf.org.

Roller Unc. e754 is cold-sensitive: lethal at 15C.

Heterozygotes are WT and segregate WT, Vul, Unc lethals (early larval) and dead eggs. Maintain by picking WT.

Abnormal feeding: slow, regular pumping. Vulvaless (incomplete penetrance). Unc.

ad810 is homozygous lethal. ad810/+ is Egl and it suppresses gpb-2. gpb-2 phenotype is rather subtle: they are slightly starved, slightly longer than normal, and tend to be loopy in their movements (they make abnormally deep bends). Hets should be Egl and non-Eat. On most E. coli strains gpb-2 grows rather poorly, especially if the plates are older so that there is a thick and tough lawn. On such plates there will be a lot of gpb-2 larval arrest, and those that don't arrest will grow slowly. The hets should easily outgrow the gpb-2 homozygotes. [gpb-2 is also hypersensitive to the drug arecoline: they won't grow on 5 mM. The hets will grow even better than WT on 5 mM arecoline.] gpb-2(ad541) previously called eat-11(ad541).

Temperature sensitive embryonic lethal. Maintain at 15 C. 6% hatching rate at 25 C. Reference: Johnston et al. (2010) Curr Biol.

Semi-dominant temperature-sensitive embryonic lethal. Maintain at 15C.

Recessive, early stop mutation within the coding sequence (C to T substitution in aa52) makes sa734 a likely null allele. May grow slightly better at 15C. Hyperactive, lays early stage eggs, increased amplitude of locomotory wave-form. Suppresses the lethargy and egg-laying defects of unc-43(n498). Reverses direction of locomotion more frequently than WT.

tnEx109 [kin-1(+) + sur-5::GFP]. Segregates GFP+ fertile animals and GFP- kin-1(ok338) animals (early larval lethal). Reference: Kim S, et al. 2012 Genetics

tnEx212 [pod-2(+) + sur-5::GFP]. Pick GFP+ animals to maintain. sur-5::gfp(+) animals are wild type and segregate GFP(+) wild-type animals and GFP(-) pod-2(tn1691) dead embryos. tn1691 deletes ~15 kb within pod-2, including most of Exon 2 through to and including the stop codon (but not the polyA site). Reference: Starich TA, et al. eLife 2020;9:e58619 DOI: 10.7554/eLife.58619 PMID: 32735213

Heterozygotes are WT and segregate WT, Unc-32 maternal effect lethals (Mel) and Unc-36.

Temperature sensitive. Embryonic lethal at 25C (tight); arrests at first cleavage. Gondadogenesis defective. Will grow at 15C or 20C. Maternal effect (m,m).

Temperature sensitive. Embryonic lethal. Gonadogenesis abnormal. Recessive. Maternal effect (m,m). Strict. Does not grow at 20C or 25C.

Temperature sensitive. Semi-dominant. Egg lethal. Not maternal. Will grow at 20C.

Temperature sensitive lethal. Maintain at 15C. Endocytosis defects in oocytes (non-ts) and coelomocytes (ts).

Temperature sensitive lethal. Endocytosis defective. Maintain at 15C. AKA: rme-3.

DH subclone of C. briggsae Zuckerman. This stock was maintained in liquid culture for some number of years, and has acquired mutations that have not been named or mapped. It is Unc, dauer-defective and ts lethal. Previously called C. briggsae BO. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Low brood size and incompletely penetrant embryonic lethality. Accumulates yolk in the pseudocoelom of adult hermaphrodites. Males are normal.

Temperature sensitive. Embryonic lethal. Semi-dominant. Gonadogenesis defective. maternal effect (m,n). Will grow at 20C, but not 25C.

Temperature sensitive. Egg lethal. Will grow at 20C, but not 25C. Recessive. Maternal effect (m,n).

Temperature sensitive. Egg lethal. Maternal effect (m,n). Acc and Gon. Some growth at 20C, but not at 25C.

Temperature sensitive. Leaky. Penetrance incomplete. Semi-dominant. Cleavage abnormal. Maternal effect(m,m). Received new stock from Edward Kipreos 7/2003.

Temperature sensitive. Egg lethal. Abnormal first cleavage. Maternal effect (m,n).

Temperature sensitive. Egg lethal. Abnormal first cleavage. Strict maternal effect (m,m). Will grow at 20C.

Temperature sensitive. Egg lethal. Abnormal first cleavage giving small P1 blastomere. Mutant is ts in late L4-early adult. Partial maternal (m,n).

Temperature sensitive. Egg lethal. Gon phenotype if shifted to 25C early. Maternal effect (m,m).

Temperature senstive. No growth at 20C or 25C. Weakly semidominant. Egg lethal.

sup-35 rescues synthetic lethality of ubc-18 and pha-1.