Temperature sensitive. Egg lethal. Abnormal first cleavage. Maternal effect (m,n).

Complete CRISPR/Cas-9 knock-out (2317bp deletion) of the gene nlp-42(Y80D3A.10). Two times backcrossed with N2. Homozygous. Superficial wild-type. Primers for crossing: Fwd: cgagacttttaaccccgtcg InFwd: aaagcccatgacttgctgaa Rev: gctcaggtggttagagggtt Wild-type bands: 580bp, 2652bp. Mutation band: 335bp.

R07C3.1. Homozygous. Outer Left Sequence: ATGCAAGTTATGTGTGCGGA. Outer Right Sequence: GTTATTTGGAGAGGCTGCCA. Inner Left Sequence: TTTTGTGGGCCTGAGTTTTT. Inner Right Sequence: GCCGCATTATACATTCGGATA. Inner Primer PCR Length: 1270 bp. Deletion Size: 706 bp. Deletion left flank: TCCTCAGATGGAGATTATTCCTACTACAGC. Deletion right flank: ATAAGATCTATAACTCTACTACAAATGTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C29F3.5 Homozygous. Outer Left Sequence: cgttcaactcaccagatcca. Outer Right Sequence: ttcgcgccaagtctaatttt. Inner Left Sequence: ctgcccagtcaaaatcacatt. Inner Right Sequence: aggagtgatggaccaattttt. Inner Primer PCR Length: 1298. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y110A7A.20 Homozygous. Outer Left Sequence: gaatcaacaaatgcagtgcg. Outer Right Sequence: tgaaaacagaaccatcgtcg. Inner Left Sequence: tccaaccaaaaattgcttca. Inner Right Sequence: aaatgctcaaaagaatcccg. Inner Primer PCR Length: 1223. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15D4.4 Homozygous. Outer Left Sequence: ggtagatttaaagcgcgtcg. Outer Right Sequence: ttccggaaatatgcaggaag. Inner Left Sequence: agcgcgaaaaattcaatgag. Inner Right Sequence: gttcaattccggcagtttg. Inner Primer PCR Length: 1171. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F09E8.7 Homozygous. Outer Left Sequence: atcgattgctcgttgagctt. Outer Right Sequence: gctcgactttctcacttcgg. Inner Left Sequence: gctcatcatccagctcatca. Inner Right Sequence: ccgtgtcgatttttcggaat. Inner Primer PCR Length: 1300. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C24B9.9 Homozygous. Outer Left Sequence: ttatttctgggctcgcattc. Outer Right Sequence: agtagttgcggctgagttcc. Inner Left Sequence: ggtcgaagtgatacctgtgga. Inner Right Sequence: tgacattttgaagcaaatcaatg. Inner Primer PCR Length: 1238. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F41H10.6 Homozygous. Outer Left Sequence: ggggtgatttcgggtctaat. Outer Right Sequence: tccaacactcatcggattca. Inner Left Sequence: agtgaagtccgagacggaaa. Inner Right Sequence: agtatgcccaacacatccg. Inner Primer PCR Length: 1139. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y54G2A.25 Homozygous. Outer Left Sequence: gcatcgcaaacgagacataa. Outer Right Sequence: cttaggcattaggcaggcag. Inner Left Sequence: atgcgcactgtagttggtga. Inner Right Sequence: acaagtcaagcgtgtaggca. Inner Primer PCR Length: 1151. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y54G2A.25 Homozygous. Outer Left Sequence: gcatcgcaaacgagacataa. Outer Right Sequence: cttaggcattaggcaggcag. Inner Left Sequence: atgcgcactgtagttggtga. Inner Right Sequence: acaagtcaagcgtgtaggca. Inner Primer PCR Length: 1151. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807